Ask a New Question

sam

Questions and answers by sam

Questions (1,763)

A major hotel chain keeps a record of the number of mishandled bags per 1,000 customers. In a recent year, the hotel chain had
1. 1 answer
2. 3 views
Use the excerpt from the “How Nellie Bly went undercover to expose abuse of the mentally ill” article to answer the
1. 1 answer
2. 8 views
Volume of Composite 3D Figures Quick Check2 of 52 of 5 Items Question Use the image to answer the question. What is the volume
1. 1 answer
2. 68 views
Volume of Composite 3D Figures Quick Check 1 of 51 of 5 Items Question Use the image to answer the question. Solve for the
1. 6 answers
2. 212 views
Volume of Composite 3D Figures Quick Check 1 of 51 of 5 Items Question Use the image to answer the question. Solve for the
1. 1 answer
2. 90 views
upload your population and Ecosystems portfolio remember to include the following items the materials list for your simulation
1. 1 answer
2. 57 views
What are the characteristics of each type of organism? Think about things like whether they have a nucleus, how many cells they
1. 1 answer
2. 14 views
Unit 10, Lesson 6 Portfolio DirectionsAnalyzing Literary Texts Directions: In unit 10, lessons 1-5 you learned about analyzing
1. 1 answer
2. 62 views
In the folktales The Swallow and the Pumpkinseed and Don’t Count Your Chickens, the main characters are the younger brothers
1. 1 answer
2. 56 views
Surface Area of Rectangular Pyramids PracticeComplete this assessment to review what you've learned. It will not count toward
1. 1 answer
2. 98 views
How many people voted for each candidate? in Florida
1. 1 answer
2. 44 views
There is a large container which will hold 10 balls with two of the balls being purple. The balls are all the same size and
1. 1 answer
2. 42 views
There is a large container which will hold 10 balls.The balls are all the same size and texture. You are required to select two
1. 1 answer
2. 20 views
How much larger is the calculation of the volume of a sphere's whose radius is 51 inches if π is used instead of 3.14?
1. 1 answer
2. 29 views
John has three chances of throwing and hitting the target to win the prize. One hit wins John the prize. What is the probability
1. 1 answer
2. 40 views
find the area of the compose figure in square units the numbers are 4 3 2 and 5
1. 1 answer
2. 91 views
A scale drawing of the triangle below is made. The height of the scale drawing is 2in. What is the area of the scale drawing? *
1. 1 answer
2. 62 views
What is the area of the composite figure?2 points 49 square inches 220 square inches 362 square inches 174 square inches
1. 1 answer
2. 69 views
The closet floor design pictured below has an area of 66 square feet. What is the measurement of the missing length?* 2 points 6
1. 1 answer
2. 62 views
What is the area of the composite figure?* 2 points Captionless Image 54 square inches 121 square inches 91 square inches 81
1. 1 answer
2. 93 views
The statement below is from a document."Without support from Congress or the President, efforts to avoid compliance with enacted
1. 3 answers
2. 104 views
The Venn diagram below shows some services provided by governments.A B Which service could go where the "?" is in the Venn
1. 1 answer
2. 68 views
The Venn diagram below shows some services provided by governments.A B Which service could go where the "?" is in the Venn
1. 1 answer
2. 47 views
find the area of the figure below A. 42 m2 B. 45 m2 C. 60 m2 d. 75 m2
1. 1 answer
2. 32 views
Complete the table by finding the circumference and area of a circle with a radius of 3 feet. Substitute 3.14 for pi. Express
1. 3 answers
2. 129 views
Complete the table by finding the circumference and area of a circle with a radius of 3 feet. Substitute 3.14 for pi. Express
1. 1 answer
2. 127 views
39.5+667+ ? =180
1. 1 answer
2. 65 views
What is the area of the figure in square centimeters?4cm 8cm 10cm
1. 3 answers
2. 84 views
Essay on my new year resolution
1. 1 answer
2. 21 views
the drawing of a circle and it properties
1. 1 answer
2. 19 views
how military came into power
1. 1 answer
2. 17 views
What are the three main steps to get out of online bullying harassment and abuse?
1. 1 answer
2. 47 views
What is the difference between the time in Europe and the time in Asia
1. 6 answers
2. 31 views
A town’s population has grown by 600 people in the last 2 years. On average, how many people will the town grow by in 5 years?
1. 10 answers
2. 78 views
An oil spill covers 4 square kilometers in 14 of an hour. At this rate, how many square kilometers will it cover in 2 hours?
1. 7 answers
2. 27 views
An investor needs to double his money in seven years to reach his financial goals. What is the lowest rate of return he must
1. 2 answers
2. 84 views
If you invested $1000.00 for 3 years at rate of 5% compound interest, what would be the value of your investment after the term?
1. 2 answers
2. 94 views
Brenda can buy a used motorcycle for $1500 cash, or she can pay a down payment of 10% and make 24 monthly payments of $64.80.
1. 2 answers
2. 180 views
James deposited $7,500 in a savings account for 1 year at a rate of 2% per year. How much interest will he earn?
1. 2 answers
2. 111 views
Megan deposited $3,500 in a savings account for 1 year at a rate of 1.5% per year. How much interest will she earn?
1. 2 answers
2. 192 views
h(t) = -0.81(3.0864)^2 + 5(3.0864)h(t) = 4.938
1. 2 answers
2. 60 views
t = -5 / (2 * -0.81)
1. 2 answers
2. 39 views
Harrison and Lara—two tireless adventurers who face mathematical roadblocks and puzzles wherever they go—have a new
1. 2 answers
2. 102 views
Five sisters have birthdays in different months from each other (February, March, June, July and December), and on different
1. 2 answers
2. 143 views
Five sisters have birthdays in different months from each other (February, March, June, July and December), and on different
1. 2 answers
2. 117 views
A model rocket is fired from the side of a hill and its flight is given by the quadratic equation shown here:ℎ(𝑡𝑡) =
1. 5 answers
2. 281 views
A school's Safe Grad Committee wants to hire busses and vans for a trip to Magic Mountain in Moncton, New Brunswick. Each bus
1. 4 answers
2. 200 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 2 answers
2. 141 views
A school's Safe Grad Committee wants to hire busses and vans for a trip to Magic Mountain in Moncton, New Brunswick. Each bus
1. 3 answers
2. 204 views
A local shop sells two different types of tea. They know that the maximum number of cups of orange pekoe tea and chamomile tea
1. 2 answers
2. 309 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 2 answers
2. 201 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 2 answers
2. 194 views
A rectangular playing field will be divided by fences as shown here. A total of 800 metres of fence isavailable. Since we
1. 7 answers
2. 162 views
rocket is fired off the ground at a target 200 metres away. It is designed to reach a height of 250metres as it heads toward its
1. 2 answers
2. 148 views
Jey is interviewing for a new position. He has just completed a master of fine arts degree and has been working for his current
1. 2 answers
2. 155 views
Selma is working on a marketing plan for her business and thinks it would be best to divide her target market into several
1. 2 answers
2. 135 views
what affect does shakespeare’s use of personification have? Act 4, scene 5 of romeo and juliet
1. 1 answer
2. 201 views
If producers generate 100% of the energy, what percentage of that energy is left by the time it reaches tertiary consumers?
1. 4 answers
2. 202 views
Define “carbon source” and “carbon sink.” Give two examples of each.
1. 1 answer
2. 93 views
What do the Etowah Mounds tell us about prehistoric societies in Georgia (think about tools, resources, culture, etc.)?
1. 2 answers
2. 287 views
You have the choice of flipping a fair coin and winning a game when heads appear, or you can roll a single standard die and
1. 1 answer
2. 87 views
495,346 to 500,000
1. 1 answer
2. 85 views
The density of osmium (the densest metal) is 22.57 g/ cm3. If a 1.00 kg rectangular block of osmium has two dimensions of 4.00
1. 3 answers
2. 148 views
Lillie read an average of 5 books per month in the first nine months of the year. In the last three months of the year, she read
1. 2 answers
2. 93 views
Mr Badger buy 12 pens for $x each. The price of the pens have now increased by 15cents each. And he can only afford to buy 10
1. 3 answers
2. 329 views
A woman weighs 125 lbs on the surface of the earth ( radius = 3960 miles). At what distance above the surface of the earth would
1. 1 answer
2. 265 views
What is the relative frequency of male passengers?Round to the nearest hundredth, if needed. 0.15 0.27 0.43 0.75
1. 2 answers
2. 218 views
Find the interval(s) where the function is increasing and the interval(s) where it is decreasing. (Enter your answers using
1. 3 answers
2. 457 views
How did the role of the church in education change over time?A.Universities changed from being independent to being part of the
1. 3 answers
2. 866 views
jonathan sabastion batch composed much of his music around what insurment family? (1 point)a.brass b.percussion c.keybord
1. 7 answers
2. 540 views
What are the various uses and benefits of rocks in everyday life?
1. 1 answer
2. 365 views
hello smart people i need a little help please can anyone help with this practice quiz please. (if not please move along iv been
1. 5 answers
2. 401 views
hello BEUTIFULL people 🥰 can you please help me whith this quizWhich of the following was one major effect of the bubonic
1. 12 answers
2. 761 views
Which region was the center of Moorish culture on the Iberian Peninsula?A. Castile-León B. Aragon C. Majorca D. al-Andalus
1. 40 answers
2. 11,060 views
1.find the area of the tryangle (1 point)a.16.4 b.11.55 c.23.1 d.4.55 but i dont want answers i just need help i do read my
1. 1 answer
2. 444 views
Which sentence provides information about a character's physical appearance?
1. 2 answers
2. 1,784 views
two forces 4n and 5n act on a body in direction due north and due east respectively calculate their equilibria
1. 1 answer
2. 356 views
(c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
1. 1 answer
2. 297 views
b) BclI cleaves after the first T:3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang?
1. 1 answer
2. 254 views
a) BamHI, cleaves after the first G:3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang?
1. 1 answer
2. 208 views
Suppose T is a transformation from ℝ2 to ℝ2. Find the matrix A that induces T if T is reflection over the line y=−5/3x.
1. 3 answers
2. 718 views
slope 5/4 passing through -1,9
1. 2 answers
2. 188 views
In the function y= 5cos(x+ 2π/3)-6 is translated K unit up words resulting in a Maximum y-value of 14, the value of K is _____.
1. 1 answer
2. 198 views
For the trigonometric function y = tan(¾ x), the period can be expressed as aπ/b radians.
1. 1 answer
2. 141 views
A 25 kg object travels at 52 m/s West collides with a 39 kg object at rest. If the object sticks together on contact, the
1. 1 answer
2. 181 views
A shortage of gold causes the price of gold wire to increase by 140%. If 10 feet of gold wire previously cost $50, what is the
1. 4 answers
2. 455 views
what 2 numbers greater than 40 have only 2 or 3 for prime numbers
1. 1 answer
2. 164 views
I am an even multiple of 2. If you reverse my digits, I become a multiple of 9. Who am I?
1. 1 answer
2. 234 views
Blake’s balance in his checking account at the beginning of the month was $42.68. Blake’s bank statement for this month
1. 1 answer
2. 267 views
risky behaviour of a social
1. 1 answer
2. 238 views
The difference between static friction and kinetic (sliding) friction is that
1. 1 answer
2. 240 views
Suppose that the average pop song length in America is 4 minutes with a standard deviation of 1.25 minutes. It is known that
1. 2 answers
2. 796 views
what are the dimentions of three different rectangular prisms that each have a surface area of 72?
1. 4 answers
2. 629 views
In a amusement park ride, gondola cars of weight W are attached by rods 24ft long to a bullwheel 16ft in diameter. The bull
1. 4 answers
2. 638 views
A magnetic particle weighing 3.6 grams is pulled through a solenoid with an acceleration of6m/s2. Compute the force in pounds
1. 4 answers
2. 1,327 views
When a 644 lb boat is moving at 10fps, the motor conks out. How much farther will the boatglide, assuming its resistance to
1. 5 answers
2. 2,005 views
For Set A, how many of the numbers are greater than 42? _____Set A 1|0 2|1 1 4 4 3|5 4|0 1 3 5|0 1
1. 1 answer
2. 203 views
Referring to the Fig. in Question #22, think about first picking a card and thenrolling the die. Give the probability in
1. 1 answer
2. 273 views
The Downtown Theater has 1 ticket window. In how many ways can 4 peopleline up to buy tickets?
1. 3 answers
2. 319 views
The Downtown Theater has 1 ticket window. In how many ways can 3 peopleline up to buy tickets? _____
1. 1 answer
2. 276 views

Pages

1
2
3
4
5
6
7
8
9
10

Ask a New Question

Archives
Categories
Contact Us
Newest
Privacy Policy
Terms of Use
© 2024