a) BamHI, cleaves after the

  1. a) BamHI, cleaves after the first G:3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang?
    1. answers icon 0 answers
    2. sam asked by sam
    3. views icon 267 views
  2. (c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
    1. answers icon 0 answers
    2. sam asked by sam
    3. views icon 358 views
  3. Give the sequence of a reverse primer used to insert a BamHI site (GGATCC) at the 3' end of the following sequence:5'
    1. answers icon 0 answers
    2. Peter Parker asked by Peter Parker
    3. views icon 411 views
  4. Give the sequence of a reverse primer used to insert a BamHI site (GGATCC) at the 3' end of the following sequence:5'
    1. answers icon 0 answers
    2. Jorge asked by Jorge
    3. views icon 590 views
  5. b) BclI cleaves after the first T:3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang?
    1. answers icon 0 answers
    2. sam asked by sam
    3. views icon 308 views
  6.  A new drug is developed which selectively cleaves covalentbonds between two sulfur atoms of non-adjacent amino acids in a
    1. answers icon 3 answers
    2. Kondwani moyo asked by Kondwani moyo
    3. views icon 200 views
  7. The restriction enzyme BamHI recognises the sequence 5’-G^GATCC-3’, cleaving between the first and second G, as indicated.
    1. answers icon 2 answers
    2. Arran asked by Arran
    3. views icon 831 views
  8. DNA was collected from 100 people and subjected to a restriction digest with BamHI. These samples were then analyzed using
    1. answers icon 0 answers
    2. Tammy asked by Tammy
    3. views icon 778 views
  9. Staphylococcal nuclease (Staph Nuc) is a heat-stable, potent secretory protein that cleaves dsDNA in vitro. You have a cloned
    1. answers icon 0 answers
    2. annslee asked by annslee
    3. views icon 537 views
  10. Staphylococcal nuclease (Staph Nuc) is a heat-stable, potent secretory protein that cleaves dsDNA in vitro. You have a cloned
    1. answers icon 0 answers
    2. UAB asked by UAB
    3. views icon 537 views