Ask a New Question

a) BamHI, cleaves after the

a) BamHI, cleaves after the first G:3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang?
1. 0 answers
2. asked by sam
3. 259 views
(c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
1. 0 answers
2. asked by sam
3. 346 views
Give the sequence of a reverse primer used to insert a BamHI site (GGATCC) at the 3' end of the following sequence:5'
1. 0 answers
2. asked by Peter Parker
3. 396 views
Give the sequence of a reverse primer used to insert a BamHI site (GGATCC) at the 3' end of the following sequence:5'
1. 0 answers
2. asked by Jorge
3. 578 views
b) BclI cleaves after the first T:3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang?
1. 0 answers
2. asked by sam
3. 298 views
 A new drug is developed which selectively cleaves covalentbonds between two sulfur atoms of non-adjacent amino acids in a
1. 3 answers
2. asked by Kondwani moyo
3. 193 views
The restriction enzyme BamHI recognises the sequence 5’-G^GATCC-3’, cleaving between the first and second G, as indicated.
1. 2 answers
2. asked by Arran
3. 812 views
DNA was collected from 100 people and subjected to a restriction digest with BamHI. These samples were then analyzed using
1. 0 answers
2. asked by Tammy
3. 764 views
Staphylococcal nuclease (Staph Nuc) is a heat-stable, potent secretory protein that cleaves dsDNA in vitro. You have a cloned
1. 0 answers
2. asked by annslee
3. 528 views
Staphylococcal nuclease (Staph Nuc) is a heat-stable, potent secretory protein that cleaves dsDNA in vitro. You have a cloned
1. 0 answers
2. asked by UAB
3. 532 views