Question

To confirm that the recombinant plasmids obtained were exactly what you wanted, you need to determine the DNA sequence of the PCR products found in several of the recombinant plasmids. To do this, you use the primer 5'-CACG-3'. You carry out a set of four dideoxy sequencing reactions that include template DNA, DNA polymerase, the appropriate buffer, and the radiolabeled DNA primer. In each reaction, you include all four deoxynucleoside triphosphates (dNTPs) and a small amount of one of the four dideoxynucleoside triphosphates (ddNTPs).

The sequence of the original gene is given again below. If the recombinant plasmid is carrying this sequence, drag and drop the first 12 bands to create the pattern expected for the sequencing reactions as outlined above. Use the dotted lines as guides. The lines are numbered 1-12 for placement of the 12 bands and represent the fragments from smallest to largest.

Place the band in the correct location so it is centered on the gray lines. Like this: An image showing that a properly placed band should be centered on any available line.

A diagram of the double-stranded DNA sequence of the same small gene as above is depicted. An asterisk marks the transcription start site. The gene is 54 nucleotides long. The top strand reads: CACGTTATTAACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG. The bottom strand reads: GTGCAATAATTGGACTACCGGCAATTAGATAAATTCCGGACTTCATTGCATACC

Answer 1

Put bands from bottom(+ ve) to top (- ve) in following order -
TTATTAACCTGAT