bio

This page lists questions and answers that were posted by visitors named bio.

Questions

The following questions were asked by visitors named bio.

what are significants of Evolution of Eukaryotes ?

so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)

A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?

Answers

The following answers were posted by visitors named bio.

Here is the answer I am 100% right I just took the test. C B D A C Trust me I am 100% right.

Thank god for the person above me I couldn't find answers anywhere