Archive day

March 19, 2026

1,259 public questions were asked on this day.

← Mar 18 Mar 20 →
Provide the polypeptide/protein that would be made from the following mRNA strand AUGGUACUCAUCAUACCCUAA
Asked by A 1 answer
DIRECTIONS: THINK ABOUT THE MEANING OF THE TWO WORDS IN PARENTHESES. CHOOSE THE WORD WITH THE CONNOTATION THAT BEST FITS THE SENTENCE. THEN WRITE WETHER IT HAS A POSITIVE OR NEGATIVE CONNOTATION 1. EVA WAS IN AWE OF THE...
Asked by AHH 1 answer
Provide the polypeptide that would be made from the following mRNA strand AUGGUACUCAUCAUACCCUAA
Asked by A 1 answer
Template DNA Strand T A C C A T G A G T A G T A T G G G A T T Transcription - I can predict what RNA would be produced (transcribed) from a given DNA sequence Copy the Template DNA Strand from question 2B then fill in th...
Asked by A 1 answer
sentence with the word sanction
Asked by Eli 1 answer
sentences with the word radiation
Asked by Eli 1 answer
Divide. Write your answer in simplest form. 25x3–x/6 ÷ 25x2–1/6
Asked by h 1 answer
DNA Sequences - I can appropriately fill in missing parts of a DNA molecule. Fill in the blanks, with the capital letters of the bases, for each of the following: Non-Template DNA Strand A T G G T A C T C A T C A T A C C...
Asked by A 1 answer
ind the discriminant. 2q= – 2q2–2 How many real solutions does the equation have?
Asked by h 1 answer
sentence with the word Holocaust
Asked by Eli 1 answer
Complete the following table to compare dna and rna: Molecule | # of strands | sugar type | names of the nitrogenous bases DNA| ? | ? | ? RNA | ? | ? | ?
Asked by A 1 answer
3 sentences with the word ghetto
Asked by Eli 1 answer
Use the image to answer the question. Right triangle upper A upper B upper C has a small square box at angle B. The side opposite of each angle is labeled as the lowercase letter of the angle name. ▶Click for Long Desc U...
Asked by puyr 1 answer
Right triangle upper A upper B upper C has a small square box at angle B. The side opposite of each angle is labeled as the lowercase letter of the angle name. ▼Click for Long Desc The adjacent side, from angle upper A t...
Asked by puyr 1 answer
a sentence for the word biological warfare
Asked by Eli 1 answer
appeasement in a sentence
Asked by Eli 1 answer
The Inventor’s Fair This selection is from a play about middle schoolers preparing for an inventor’s fair. Characters EMMA LIAM PETER MS. ESTY SCENE 1 1 [A spotlight reveals MS. ESTY, alone at the edge of the stage. She...
Asked by amour 1 answer
The Inventor’s Fair This selection is from a play about middle schoolers preparing for an inventor’s fair. Characters EMMA LIAM PETER MS. ESTY SCENE 1 1 [A spotlight reveals MS. ESTY, alone at the edge of the stage. She...
Asked by amour 1 answer
What can a researcher conclude if she cannot find any information to support her initial topic?(1 point) She has chosen a topic that will require her to make too many inferences. She has chosen a topic that covers too la...
Asked by no name 1 answer
The Inventor’s Fair This selection is from a play about middle schoolers preparing for an inventor’s fair. Characters EMMA LIAM PETER MS. ESTY SCENE 1 1 [A spotlight reveals MS. ESTY, alone at the edge of the stage. She...
Asked by amour 1 answer
What should a researcher do after making inferences during the inquiry process?(1 point) They should decide if their topic is too broad. They should narrow their topic so making inferences is not necessary. They should r...
Asked by no name 1 answer
How is an outline different from a concept web?(1 point) The outline lacks a strict organizational structure, while the concept web is based on a formal structure. An outline uses Roman numerals to organize, while a conc...
Asked by no name 1 answer
A student is writing a research paper on farming in the United States and is forming a research question. What is a strong research question on this topic? Select the two correct answers.(1 point) What region of the Unit...
Asked by no name 1 answer
What is true about a good research question? Select the two correct answers.(1 point) It begins with a word like who, when, or where. It requires sustained research to answer. It holds the writer’s and reader’s interest....
Asked by no name 1 answer
3 synonyms for the word sanction
Asked by Eli 1 answer