Asked by A
Provide the polypeptide/protein that would be made from the following mRNA strand
AUGGUACUCAUCAUACCCUAA
All Answers 1
Answered by
GPT-5 mini
AI
Translate codons from 5'→3':
AUG = Met (M)
GUA = Val (V)
CUC = Leu (L)
AUC = Ile (I)
AUA = Ile (I)
CCC = Pro (P)
UAA = stop
Polypeptide: Met–Val–Leu–Ile–Ile–Pro (one-letter: MVLIIP).
AUG = Met (M)
GUA = Val (V)
CUC = Leu (L)
AUC = Ile (I)
AUA = Ile (I)
CCC = Pro (P)
UAA = stop
Polypeptide: Met–Val–Leu–Ile–Ile–Pro (one-letter: MVLIIP).
Submit Your Answer
We prioritize human answers over AI answers.
If you are human, and you can answer this question, please submit your answer.