Visitor activity

A

Public contributions from visitors who posted under the name A.

Questions 397
Answers 0

Recent questions

Latest questions from A

In which ways can an actor sharpen their skills as a performer? Select all that apply. Group of answer choices play video games observe people in everyday life watch professional actors practice often Flag question: Ques...
1 answer
A college degree in theater management is the best way to become which of the following? Group of answer choices stunt coordinator writer actor producer Flag question: Question 2 Question 21 pts Which person holds a larg...
1 answer
Which invention from 1926 allowed sound to be added to film? Group of answer choices aroma-turgy CGI Vitaphone 3D printing Flag question: Question 2 Question 21 pts How has automation affected the world of theater? Group...
1 answer
Which actor used a comedic style of fighting in their acting? Group of answer choices Marlon Brando Laurence Olivier Jackie Chan Gal Gadot Flag question: Question 2 Question 21 pts Which actor’s philosophy of acting was...
1 answer
Muscular Dystrophy is a recessive disorder that is carried on the X chromosome. A woman who is a carrier for this disorder marries a man who does not have this trait. A) allele key: ____ = normal ____ = muscular dystroph...
1 answer
A mother with a certain trait has four soms and one daughter. All of her sons have this trait and her daughter is a carrier. This is likely due to an inheritance pattern that is: a. dominant/recessive b. X-inked c. incom...
1 answer
6) Mutations - DNA and Proteins - I can identify how a mutation impacts DNA and proteins. 6A)Name and define two general types of mutations. (4 pts) Type 1: Type 2:
1 answer
5) Cell Locations - I can identify the different parts of a cell that are involved in making a protein. 5A)Transcription - Provide the specific cell location where each of the following is made: (2pts) Ribosomes = ______...
1 answer
Provide the polypeptide/protein that would be made from the following mRNA strand AUGGUACUCAUCAUACCCUAA
1 answer
Provide the polypeptide that would be made from the following mRNA strand AUGGUACUCAUCAUACCCUAA
1 answer
Template DNA Strand T A C C A T G A G T A G T A T G G G A T T Transcription - I can predict what RNA would be produced (transcribed) from a given DNA sequence Copy the Template DNA Strand from question 2B then fill in th...
1 answer
DNA Sequences - I can appropriately fill in missing parts of a DNA molecule. Fill in the blanks, with the capital letters of the bases, for each of the following: Non-Template DNA Strand A T G G T A C T C A T C A T A C C...
1 answer
Complete the following table to compare dna and rna: Molecule | # of strands | sugar type | names of the nitrogenous bases DNA| ? | ? | ? RNA | ? | ? | ?
1 answer
In 7-10 Sentences, Explain what you found interesting about the video "What is Evolution". What questions do you have about the video and evolution? What would you like to learn in this unit? 6th grade response
1 answer
In 7-10 Sentences, Explain what you found interesting about the video "What is Evolution". What questions do you have about the video and evolution? What would you like to learn in this unit?
1 answer
Draw a triangle with one side length of 5 units and another side length of 7 units. What additional piece of information will guarantee that only one triangle can be drawn?
1 answer
Pierce draws a circle with a radius of 3 centimeters. Gianna draws a circle with a radius that is twice as long as the radius of Pierce's circle. How will the circumference of Gianna's circle compare with the circumferen...
1 answer
What is the measure of ∠BZD? A. 58 degrees B. 148 degrees C. 32 degrees D. 90 degrees
1 answer
On a map, 1 inch equals 150 miles. The border between two states is 5.5 inches long on the map. What is the actual length of the border?
1 answer
How are adjacent angles and vertical angles alike? How are they different?
1 answer
Find the area of the circle. Use 3.14 for π
1 answer
Is an area calculation exact when you use 3.14 or 22/7 as a value for π Explain. like a 6th grader
1 answer
Is an area calculation exact when you use 3.14 or 22/7 as a value for π Explain.
1 answer
How can the area formula for a circle be used to solve problems?
1 answer
What circular area is covered by the signal if the circumference is 754 miles? explain like a 6th grader
1 answer

Recent answers

Latest answers from A

No public answers found for this visitor name.