Ask a New Question

The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):

!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
What is its mRNA nucleotide sequence?

Indicate the product of this DNA segment/gene.
What is the product’s primary structure?
How many peptide bonds are in the product?

Ask a New Question or answer this question.

Similar Questions

The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
if you being with a strand of dna 21 nucleotides long it will be transcribed by ___into a strand containing ___ codons. if it
1. 1 answer
A mutation in DNA subsequently causes a premature STOP codon in the mRNA strand. What happens when the ribosome reaches a STOP
1. 1 answer
Which of the following is true of a stop codon?A stop codon adds a poly-A tail to a messenger ribonucleic acid (mRNA). A stop
1. 1 answer

more similar questions