The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
1A. What is its mRNA nucleotide sequence?
AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC
1B. Indicate the product of this DNA segment/gene.
1C. What is the product’s primary structure?
1D. How many peptide bonds are in the product?
Not sure if I did part A right, but I need help with the other questions.
Thanks!!