Ask a New Question

Question

The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
What is its mRNA nucleotide sequence?

Indicate the product of this DNA segment/gene.
What is the product’s primary structure?
How many peptide bonds are in the product?
14 years ago

Answers

Related Questions

is using a template the best way to create a personalized announcement? For instance if i want to se... for template DNA (non-GMO,GMO,and test food) we set up a PCR reaction that included "plant' primers... On the template, you will need to do the following: 1. Type your FIRST AND LAST name as it is in... If the DNA template is 3' ATC CGT ATG CGA 5', what will be the complementary mRNA for it? 3' UAG CG... If the DNA template is 3' ATC CGT ATG CGA 5', what will be the complementary mRNA for it? With a template, how can the words on a slide be changed? by creating a new text box by cl... With a template, how can the words on a slide be changed? Responses by creating a new text box... With a template, how can the words on a slide be changed? (1 point) Responses by creating a n... DNA is used as a template to synthesize Select , which carries the message from DNA to the riboso... Using the template example, create a separate slide for each significant historical event. Each slid...
Ask a New Question
Archives Contact Us Privacy Policy Terms of Use