Question
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
What is its mRNA nucleotide sequence?
Indicate the product of this DNA segment/gene.
What is the product’s primary structure?
How many peptide bonds are in the product?
!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG???
What is its mRNA nucleotide sequence?
Indicate the product of this DNA segment/gene.
What is the product’s primary structure?
How many peptide bonds are in the product?