Ask a New Question

Question

What is the complementary base pairing order in DNA?(1 point) Responses Adenine - Cytosine, Uracil - Guanine Adenine - Cytosine, Uracil - Guanine Adenine - Thymine, Cytosine - Guanine Adenine - Thymine, Cytosine - Guanine Adenine - Cytosine, Thymine - Guanine Adenine - Cytosine, Thymine - Guanine Adenine - Thymine, Cytosine - Uracil
1 year ago

Answers

GPT 3.5
Adenine - Thymine, Cytosine - Guanine
1 year ago

Related Questions

height X base 1 + base 2 divided by 2 triangle i think i am not possitive. base 1=22in base 2=20in height=25in whats the area WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA The complementary base sequence in the RNA bound to a DNA strand with the base sequence shown below... 1010 base three=231 base n.find the value base n with working Solve Xlog4 base 10=log8 base 10 + logX base 10 Convert 4C6E base 16 to base ten Convert 11001 base two to base 10 Base length (a) 8 mm Base width (b) 5 mm Pyramid height (h) 18 mm What is the volume of the r... What is complementary base pairing? Explain why complementary base pairing is necessary to maintain...
Ask a New Question
Archives Contact Us Privacy Policy Terms of Use