Ask a New Question

Question

The complementary base sequence in the RNA bound to a DNA strand with the base sequence shown below would be ____________________.
-C-C-G-A-T-T-

A) -G-G-C-T-A-A-
B) -A-A-U-C-G-G-
C) -C-C-G-A-T-T-
D) -G-G-C-U-A-A-
8 years ago

Answers

Joe Mama
no u
5 years ago

Related Questions

WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA If the base sequence along a segment of DNA were TCGTA,what would be the antisense oligonucleotide s... which rna base sequence would produce the animo acid sequence: Valine ALanine The sequence {ak}112 (base)k=1 satisfies a1=1 and an=1337+n/an−1, for all positive integers n. Let... what is the base sequence of the DNA gene that originally produced the mRNA codon? TCC TCA UCA A... What is the complementary base pairing order in DNA?(1 point) Responses Adenine - Cytosine, Uracil -... The three-base sequence on DNA that codes for an amino acid is called a/an Group of answer choices... What is complementary base pairing? Explain why complementary base pairing is necessary to maintain... Given the mRNA base sequence of: AUG UUC GCU Please use the codon chart or wheel to determine...
Ask a New Question
Archives Contact Us Privacy Policy Terms of Use