Question

BIO 12 DNA DOUBLE HELIX.

Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand?

Original DNA Double Helix:

TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 would be between the second and third C, Position #3 would be between the fourth G and lastly, position #4 would be on the fifth C.

Top Strand = ATG || CCC || TAT || GGC || GGC || CAA || GTG || TGCU ||
Bottom Strand = AUG || CCC || UAU || GGC || GGC || UGU || GCU ||

3. What peptide would be produced if an extra thymine were accidentally inserted into the DNA strand at position #1?

5. What sequence of amino acids would be produced if the nucleotide at position #3 was somehow substituted by cytosine?

5. What sequence of amino acids would be produced if the nucleotide at position #3 was somehow substituted by cytosine?


Thank you very much for your time and consideration! :D