Asked by bio
so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG)
trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)
trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)
Answers
Answered by
bobpursley
ACC<b> TGA</b> TGG CCG TTA ATC TAT TTA AGG CCT GAA GTA ACG TAT GG
TGA Ter [end]
Ok
TGA Ter [end]
Ok
Answered by
bio
Ter?
There are no AI answers yet. The ability to request AI answers is coming soon!
Submit Your Answer
We prioritize human answers over AI answers.
If you are human, and you can answer this question, please submit your answer.