Ask a New Question

Questions and answers by

sam

Questions (2,083)

How is DNA used to identify different organisms?(1 point)Responses by counting the number of chromosomes in each cell by
1. 1 answer
2. 7 views
What is the most important function of visualizing chromosomes with a karyotype?(1 point)Responses Chromosome visualization
1. 1 answer
2. 6 views
Which controls the instructions that affect an organism’s characteristics?(1 point)Responses the number of chromosomes the
1. 1 answer
2. 9 views
Karyotyping can be used to identify(1 point)Responses genetic sequences. genetic sequences. cancer. cancer. chromosomal
1. 1 answer
2. 10 views
Down syndrome is caused by ________ in humans.(1 point)Responses monosomy monosomy trisomy trisomy disomy disomy tetrasomy
1. 1 answer
2. 7 views
________ is the visual response to the wavelengths of sunlight.(1 point) Responses Shape Shape Texture Texture Value Value Col
1. 1 answer
2. 12 views
A _______ is a continuous mark made on a surface by a moving point.(1 point) Responses texture texture line line shape shape
1. 1 answer
2. 10 views
Which of the following is an example of an organic shape?(1 point) Responses A triangle A triangle A square A square A leaf A
1. 1 answer
2. 13 views
Which element of art is defined as an area that stands out from the space next to it because of a boundary?(1 point) Responses
1. 1 answer
2. 10 views
The Nike of Samothrace, a famous Greek sculpture, was inspired by _______.(1 point) Responses birds in flight birds in flight
1. 1 answer
2. 12 views
Two-Dimensional materials are _______.(1 point) Responses materials only used during the Renaissance materials only used during
1. 1 answer
2. 13 views
Which element of art defines the interval, or measurable distance between points or images?(1 point) Responses Shape Shape Space
1. 1 answer
2. 15 views
Which element of art defines the appearance and feel of a surface?(1 point) Responses Line Line Shape Shape Texture Texture
1. 1 answer
2. 13 views
Humanoid figures in works of art are ____________.(1 point) Responses modeled after their artist modeled after their artist
1. 1 answer
2. 12 views
_________ is the degree of light or dark in artwork(1 point) Responses Value Value Texture Texture Contrast Contrast Space
1. 1 answer
2. 13 views
Cindy won $50.00 for getting first place in the Science Fair. She spent her winnings on robotics kits and chemistry sets. Each
1. 1 answer
2. 10 views
Which of the following options could use both intercepts to produce viable solutions? (1 point)Responses (temperature, number of
1. 1 answer
2. 11 views
Which of the following examples represents a discrete data constraint with viable solutions?(1 point)Responses average score on
1. 1 answer
2. 14 views
The school soccer team is selling chips to fundraise for new jerseys. If they charge $2.50 per bag of chips, how many bags would
1. 1 answer
2. 15 views
For a large group of students, the Boston Ballet charges a flat rate of $50.00, plus $15.00 per ticket. How much would a school
1. 1 answer
2. 18 views
A major hotel chain keeps a record of the number of mishandled bags per 1,000 customers. In a recent year, the hotel chain had
1. 1 answer
2. 34 views
Use the excerpt from the “How Nellie Bly went undercover to expose abuse of the mentally ill” article to answer the
1. 1 answer
2. 37 views
Volume of Composite 3D Figures Quick Check2 of 52 of 5 Items Question Use the image to answer the question. What is the volume
1. 1 answer
2. 97 views
Volume of Composite 3D Figures Quick Check 1 of 51 of 5 Items Question Use the image to answer the question. Solve for the
1. 6 answers
2. 291 views
Volume of Composite 3D Figures Quick Check 1 of 51 of 5 Items Question Use the image to answer the question. Solve for the
1. 1 answer
2. 142 views
upload your population and Ecosystems portfolio remember to include the following items the materials list for your simulation
1. 1 answer
2. 79 views
What are the characteristics of each type of organism? Think about things like whether they have a nucleus, how many cells they
1. 1 answer
2. 37 views
Unit 10, Lesson 6 Portfolio DirectionsAnalyzing Literary Texts Directions: In unit 10, lessons 1-5 you learned about analyzing
1. 1 answer
2. 94 views
In the folktales The Swallow and the Pumpkinseed and Don’t Count Your Chickens, the main characters are the younger brothers
1. 1 answer
2. 101 views
Surface Area of Rectangular Pyramids PracticeComplete this assessment to review what you've learned. It will not count toward
1. 1 answer
2. 164 views
How many people voted for each candidate? in Florida
1. 1 answer
2. 67 views
There is a large container which will hold 10 balls with two of the balls being purple. The balls are all the same size and
1. 1 answer
2. 72 views
There is a large container which will hold 10 balls.The balls are all the same size and texture. You are required to select two
1. 1 answer
2. 55 views
How much larger is the calculation of the volume of a sphere's whose radius is 51 inches if π is used instead of 3.14?
1. 1 answer
2. 46 views
John has three chances of throwing and hitting the target to win the prize. One hit wins John the prize. What is the probability
1. 1 answer
2. 63 views
find the area of the compose figure in square units the numbers are 4 3 2 and 5
1. 1 answer
2. 103 views
A scale drawing of the triangle below is made. The height of the scale drawing is 2in. What is the area of the scale drawing? *
1. 1 answer
2. 88 views
What is the area of the composite figure?2 points 49 square inches 220 square inches 362 square inches 174 square inches
1. 1 answer
2. 94 views
The closet floor design pictured below has an area of 66 square feet. What is the measurement of the missing length?* 2 points 6
1. 1 answer
2. 84 views
What is the area of the composite figure?* 2 points Captionless Image 54 square inches 121 square inches 91 square inches 81
1. 1 answer
2. 125 views
The statement below is from a document."Without support from Congress or the President, efforts to avoid compliance with enacted
1. 3 answers
2. 126 views
The Venn diagram below shows some services provided by governments.A B Which service could go where the "?" is in the Venn
1. 1 answer
2. 102 views
The Venn diagram below shows some services provided by governments.A B Which service could go where the "?" is in the Venn
1. 1 answer
2. 69 views
find the area of the figure below A. 42 m2 B. 45 m2 C. 60 m2 d. 75 m2
1. 1 answer
2. 46 views
Complete the table by finding the circumference and area of a circle with a radius of 3 feet. Substitute 3.14 for pi. Express
1. 3 answers
2. 157 views
Complete the table by finding the circumference and area of a circle with a radius of 3 feet. Substitute 3.14 for pi. Express
1. 1 answer
2. 152 views
39.5+667+ ? =180
1. 1 answer
2. 80 views
What is the area of the figure in square centimeters?4cm 8cm 10cm
1. 3 answers
2. 104 views
Essay on my new year resolution
1. 1 answer
2. 38 views
the drawing of a circle and it properties
1. 1 answer
2. 36 views
how military came into power
1. 1 answer
2. 33 views
What are the three main steps to get out of online bullying harassment and abuse?
1. 1 answer
2. 65 views
What is the difference between the time in Europe and the time in Asia
1. 5 answers
2. 56 views
A town’s population has grown by 600 people in the last 2 years. On average, how many people will the town grow by in 5 years?
1. 9 answers
2. 107 views
An oil spill covers 4 square kilometers in 14 of an hour. At this rate, how many square kilometers will it cover in 2 hours?
1. 7 answers
2. 59 views
An investor needs to double his money in seven years to reach his financial goals. What is the lowest rate of return he must
1. 1 answer
2. 101 views
If you invested $1000.00 for 3 years at rate of 5% compound interest, what would be the value of your investment after the term?
1. 1 answer
2. 114 views
Brenda can buy a used motorcycle for $1500 cash, or she can pay a down payment of 10% and make 24 monthly payments of $64.80.
1. 1 answer
2. 193 views
James deposited $7,500 in a savings account for 1 year at a rate of 2% per year. How much interest will he earn?
1. 1 answer
2. 124 views
Megan deposited $3,500 in a savings account for 1 year at a rate of 1.5% per year. How much interest will she earn?
1. 1 answer
2. 211 views
h(t) = -0.81(3.0864)^2 + 5(3.0864)h(t) = 4.938
1. 1 answer
2. 83 views
t = -5 / (2 * -0.81)
1. 1 answer
2. 61 views
Harrison and Lara—two tireless adventurers who face mathematical roadblocks and puzzles wherever they go—have a new
1. 1 answer
2. 123 views
Five sisters have birthdays in different months from each other (February, March, June, July and December), and on different
1. 1 answer
2. 161 views
Five sisters have birthdays in different months from each other (February, March, June, July and December), and on different
1. 1 answer
2. 138 views
A model rocket is fired from the side of a hill and its flight is given by the quadratic equation shown here:ℎ(𝑡𝑡) =
1. 3 answers
2. 310 views
A school's Safe Grad Committee wants to hire busses and vans for a trip to Magic Mountain in Moncton, New Brunswick. Each bus
1. 3 answers
2. 223 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 1 answer
2. 174 views
A school's Safe Grad Committee wants to hire busses and vans for a trip to Magic Mountain in Moncton, New Brunswick. Each bus
1. 1 answer
2. 226 views
A local shop sells two different types of tea. They know that the maximum number of cups of orange pekoe tea and chamomile tea
1. 1 answer
2. 334 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 1 answer
2. 225 views
A local bakery sells cakes and pies. The cakes take 2 hours of preparation time and 1 hour to decorate. The pies take 3 hours of
1. 1 answer
2. 224 views
A rectangular playing field will be divided by fences as shown here. A total of 800 metres of fence isavailable. Since we
1. 5 answers
2. 191 views
rocket is fired off the ground at a target 200 metres away. It is designed to reach a height of 250metres as it heads toward its
1. 1 answer
2. 176 views
Jey is interviewing for a new position. He has just completed a master of fine arts degree and has been working for his current
1. 1 answer
2. 175 views
Selma is working on a marketing plan for her business and thinks it would be best to divide her target market into several
1. 1 answer
2. 154 views
what affect does shakespeare’s use of personification have? Act 4, scene 5 of romeo and juliet
1. 1 answer
2. 228 views
If producers generate 100% of the energy, what percentage of that energy is left by the time it reaches tertiary consumers?
1. 2 answers
2. 234 views
Define “carbon source” and “carbon sink.” Give two examples of each.
1. 1 answer
2. 119 views
What do the Etowah Mounds tell us about prehistoric societies in Georgia (think about tools, resources, culture, etc.)?
1. 2 answers
2. 315 views
You have the choice of flipping a fair coin and winning a game when heads appear, or you can roll a single standard die and
1. 1 answer
2. 109 views
495,346 to 500,000
1. 0 answers
2. 101 views
The density of osmium (the densest metal) is 22.57 g/ cm3. If a 1.00 kg rectangular block of osmium has two dimensions of 4.00
1. 1 answer
2. 204 views
Lillie read an average of 5 books per month in the first nine months of the year. In the last three months of the year, she read
1. 2 answers
2. 130 views
Mr Badger buy 12 pens for $x each. The price of the pens have now increased by 15cents each. And he can only afford to buy 10
1. 1 answer
2. 366 views
A woman weighs 125 lbs on the surface of the earth ( radius = 3960 miles). At what distance above the surface of the earth would
1. 1 answer
2. 304 views
What is the relative frequency of male passengers?Round to the nearest hundredth, if needed. 0.15 0.27 0.43 0.75
1. 2 answers
2. 253 views
Find the interval(s) where the function is increasing and the interval(s) where it is decreasing. (Enter your answers using
1. 1 answer
2. 505 views
How did the role of the church in education change over time?A.Universities changed from being independent to being part of the
1. 2 answers
2. 904 views
jonathan sabastion batch composed much of his music around what insurment family? (1 point)a.brass b.percussion c.keybord
1. 6 answers
2. 597 views
What are the various uses and benefits of rocks in everyday life?
1. 0 answers
2. 382 views
hello smart people i need a little help please can anyone help with this practice quiz please. (if not please move along iv been
1. 4 answers
2. 439 views
hello BEUTIFULL people 🥰 can you please help me whith this quizWhich of the following was one major effect of the bubonic
1. 12 answers
2. 780 views
Which region was the center of Moorish culture on the Iberian Peninsula?A. Castile-León B. Aragon C. Majorca D. al-Andalus
1. 40 answers
2. 11,178 views
1.find the area of the tryangle (1 point)a.16.4 b.11.55 c.23.1 d.4.55 but i dont want answers i just need help i do read my
1. 1 answer
2. 483 views
Which sentence provides information about a character's physical appearance?
1. 0 answers
2. 1,809 views
two forces 4n and 5n act on a body in direction due north and due east respectively calculate their equilibria
1. 0 answers
2. 381 views
(c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
1. 0 answers
2. 329 views
b) BclI cleaves after the first T:3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang?
1. 0 answers
2. 279 views
a) BamHI, cleaves after the first G:3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang?
1. 0 answers
2. 236 views

Pages

1
2
3
4
5
6
7
8
9
10

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025