aisha

This page lists questions and answers that were posted by visitors named aisha.

Questions

The following questions were asked by visitors named aisha.

provinces, teritorries, and capitals of each.
16 years ago
state the number of positive real zeros, negative real zeros, and imaginary zeros for g(x) = 9x^3 - 7x^2 +10x - 4
15 years ago
list all of the possible rational zeros of f(x) = 3x^5 - 7x^3 + 2x - 15.
15 years ago
solve: 8 t - 3 1 - ---- = ------ + ---- t + 5 t + 5 3
15 years ago
Evaluate C(12,10)
15 years ago
determine whether the data in the table appears to be positively skewed, negatively skewed, or normally distributed. explain
15 years ago
CheckPoint #6: Water Resource Challenges Due Thursday *Post as an attachment** in your Individual Forum . Water Resource Challenges Review Ch. 10 and 11 of your text, then complete the following: Provide at least three freshwater and three ocean water res...
15 years ago
research due day 2 (tuesday) wk 6 sci/275 Exercise: Final Paper Research Due Day 2 (Tuesday) Please post in your Individual Forum · Resource: Appendix A · Review the environmental issues that are covered in this course. · Choose an environmental issue tha...
15 years ago
Checkpoint: Legislation Legacy Resources: National Congress of American Indians Web site Country Newspaper at · Due Date: Day 5 (Friday) Please post in your Individual Forum · Post a 200- to 300-word summary of a current issue between Native Americans and...
15 years ago
the process of redrawing the boundaries of legislative districts is called what
15 years ago
the form of government used in most of louisisana's parishes is called what
15 years ago
the length of a rectangle is 3 less than 5 times its width. Write a simpified algebriac expression for the perimeter of a rectangle. If the rectangle width is tripled and its length is doubled,the perimeter of new rectangle is 92cm greater than the origin...
14 years ago
What are the values of a and b.if any,where a|b-2|<0? please some sugestions
14 years ago
A cyclist is cycling at a uniform velocity of 8m/s for 8 seconds. He then stops paddling and the cycle comes to rest in next ten seconds. Draw the velocity-time graph and calculate: (i) the average retardation.(ii) the distance covered with uniform veloci...
14 years ago
what volume of 0.1 moldm-3 HCL acid would be required to dissolve 2.3 grams of calcium carbonate equation CaCO3+2HCL----------=CaCl2+CO2+H20 (WATER)
14 years ago
The human body can survive a negative acceleration trauma incident (sudden stop) if the magnitude of the acceleration is less than (m/s2) If you are in an automobile accident with an initial speed of 101(km/h) and are stopped by an airbag that inflates fr...
13 years ago
An egg is thrown nearly vertically upward from a point near the cornice of a tall building. It just misses the cornice on the way down and passes a point a distance 48.0 m below its starting point at a time 5.00s after it leaves the thrower's hand. Air re...
13 years ago
A rocket carrying a satellite is accelerating straight up from the earth's surface. At 1.25 s after liftoff, the rocket clears the top of its launch platform, 69 m above the ground. After an additional 4.80 s , it is 1.00 km above the ground. Calculate th...
13 years ago
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion. How far did it roll during the first 5.5 s of motion? Express your answer using two significant figures. x= m
13 years ago
A ball starts from rest and rolls down a hill with uniform acceleration, traveling 170 m during the second 5.5 s of its motion How far did it roll during the first 5.5 s of motion? x=
13 years ago
Acrylic bone cement is commonly used in total joint replacement to secure the artificial joint. Data on the force (measured in Newtons, N) required to break a cement bond was determined under two different temperature conditions and in two different mediu...
13 years ago
a battery of 12v supplies a charge of 1000C to an electric device. how much work is done by the battery in moving the charge?
13 years ago
Can somebody help me with this question, it is about the book the girl who could fly How can making inferences in literature help you determine how the societal conflicts in I.N.S.A.N.E. shaped Piper's identity?
13 years ago
How can making inferences in literature help you determine how the societal conflicts can make your identity?
13 years ago
find derivative y= 3x^5-6x^3/7secx find dy/dx * xcosy= 5( y+cosx) * X^5-Y^3+8XY=466 * A RIGHT TRIANGLE HAS LEGS OF LENGTH 15M AND 7M. THE 7M LEG IS NOT CHANGING. 15M LEG IS GETTING LONGER AT RATE OF 8M PER SECOND. SO WHAT IS RATE OF CHANGE OF THE HYPOTENU...
12 years ago
find derivative y= (3x^5-6x^3)/7secx
12 years ago
a circular flower bed is surrounded by a path 3m wide the diameter is 44m what is the area of this path
12 years ago
the circumference of a circle 314cm find the radius and the area
12 years ago
the minute hand of a circular clock is 18cm long how far gdoes the tip of the hand move in 2 hours
12 years ago
2NaOH + H2SO4 yields Na2SO4+2H2O calculate the molarity of H2SO4
12 years ago
solve 2x+3y=13 with 4x+5y=23
12 years ago
i have a test tomorrow and im still not sure how to do this. can you please help me? p={a,b,c} Q={a,c,d,f} Q-P=?
12 years ago
The inverted pendulum shown consists of a uniform rod of length L and mass M hinged at its base. A spring is attached a distance h from the pendulum’s pivot and has a spring constant k. At equilibrium the pendulum is perfectly vertical. For small amplitud...
12 years ago
4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) AATAAA(sequ...
12 years ago
The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please gi...
12 years ago
a player made 20 freethrows in first half which was 80% of attemted that half. how many were attempted that half
11 years ago
A person walk up a stalled escalator in 90sec.when standing on the same escalator now moving,he is carried in 60 sec.the time he would take to walk up the moving escalator will be.
11 years ago
What would be the MOLARITY (M) of the NaBr in the same buffer solution, if its concentration is now 0.9% (w/v)? Relative atomic masses:Na = 23; Br = 80
10 years ago
if an iron cube of volume 400cm3 is immersed in water,the upthrust will be?
10 years ago
Identify key personnel working in the courtroom.Outline their role.
10 years ago
100mL of oxalic acid (H2C2O4) requires 35mL of 0.04M KMnO4 to titrate it to the endpoint. calculate the molarity of the oxalic acid.
10 years ago
what does the drop in canada's imagration rate have to do with learning about imagration and canada's role in it
10 years ago
what does intentional trade have to do with canada's free trade history
10 years ago
Looking through a microscope,I saw a Eukaryotic cell. How could I conclude if the cell is a plant or animal cell?
9 years ago
384,239
9 years ago
the area of a triangle is 40cm2. the height of it is h cm. what is the lenght of its base?
8 years ago
there are x dozen of oranges in a shop. how many oranges are there in this shop?
8 years ago
peter has n marbles. He has 5 more marbles than Tom. How many marbles does Tom have?
8 years ago
water cannot cook beans on the moon.explain
8 years ago
Choose four words in lines 54-105 and explain how they impact the tone of the wanderer poem. You will explain how their connotations all contribute to your understanding of what the speaker is feeling.
5 years ago
A carpenter has a plank of wood 3 metres long. He cut it into 2 pieces. What length is each piece of wood? Give your answer in centimetres.
4 years ago

Answers

The following answers were posted by visitors named aisha.

thank you very much
18 years ago
the colonizers were the british people, Africans became slaves because they were forced by the british people and on the other side they had no choice.
17 years ago
noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo...
15 years ago
the form of government used in most of louisisana's parishes is called what
15 years ago
i can not simplify further.
12 years ago
where did you get 274 from
12 years ago
Thankyou steve :) but what about the 'b'?
12 years ago
Q2:(The(sequence(below(begins(with(the(initiator(methione. ATG(TTC(AAT(GTT(ATG(GAT(TGG(CCC(TGG(TAA(ATG(AAA(TAGAATGAT 4pts.(Please(give(a(hypothetical(translation(of((cDNA(sequence(into(single( amino(acid(codes(if(there(is(a(C(deletion(in(the(phenylalanine...
12 years ago
or the following reaction, 141 grams of silver nitrate are allowed to react with 20.8 grams of copper.
11 years ago
yes
11 years ago
yes
10 years ago
post
10 years ago
new data released on may 27 shows that canada's immigration rate has droped by one point due to ottawa incressing the fee on citizenship application to $500 for a adultfound in ryerson immigration center
10 years ago
Yes
9 years ago
prongs of a tuning fork when struck
9 years ago
19.52
9 years ago
Can't tacle
8 years ago
no never
7 years ago
property
7 years ago
thanks u
7 years ago
Playing chess
7 years ago
can someone tell me
4 years ago
If you randomly select a card from a well-shuffled standard deck of 52 cards, what is the probability that the card you select is an Ace? (Your answer must be in the form of a reduced fraction.)
4 years ago
chemistry
3 years ago