Ask a New Question

Questions and answers by

Tony

Questions (448)

The Chocolate Delights Candy Company needs to add the following functionality to its cash register: When a customer is checking
1. 0 answers
2. 509 views
Alice and Bob share a state a| + +> + b |- -> , where the first qubit is Alice's and the second qubit is Bob's. Alice measures
1. 2 answers
2. 558 views
Evaluate � [double intergal (R xy dA)] , where R is the region bounded by x^2 +y^2 <=16 , x>=0 and y>=0
1. 1 answer
2. 555 views
Evaluate �è R xy dA , where R is the region bounded by x^2 +y^2 <=16 , x>=0 and y>=0
1. 0 answers
2. 445 views
ABC is a triangle with area equal to 20 . The incircle of triangle ABC has radius equal to 2 and the circumcircle of triangle
1. 0 answers
2. 520 views
ƒ¡ is a circle with center O . A and B are points on ƒ¡ such that the sector AOB has perimeter 40 . What is the measure of
1. 1 answer
2. 590 views
Let è be the angle between the x-axis and the line connecting the origin O(0,0) and the point P(−3,−4) , where 180<è<270.
1. 1 answer
2. 510 views
A dragonfly, at rest on a bullrush, decides to fly to a second bullrush 18 m away. It accelerates uniformly to a speed of. 5 m
1. 1 answer
2. 448 views
We use a wrench to turn nuts on bolts because they require less force. Consider a hexagonal nut 1 cm in diameter. We can tighten
1. 1 answer
2. 701 views
Let S be the sum of all the possible values of sin x that satisfy the following equation:5-2cos^2(x)-7sin(x) = 0 S can be
1. 2 answers
2. 479 views
The location of a dot P at a given time t in the x-y plane is given by (x,y) = (t - sin t, 1 - cos t). What is the distance
1. 1 answer
2. 350 views
2k+7=5k-k
1. 1 answer
2. 738 views
2k+7=5k-k
1. 1 answer
2. 479 views
In order to measure the length of a long flourescent ceiling lamp, a student makes a very small hole in a piece of paper, holds
1. 1 answer
2. 546 views
Young children with autism:A. Will never talk B. relate to people differently than typical children do C. get along better with
1. 1 answer
2. 476 views
What is the terminal speed for an 77.0kg skier going down a 44.0 degrees snow-covered slope on wooden skis uk= 0.060?Assume that
1. 0 answers
2. 828 views
The sum of a smaller number and twice a larger number is 67. If the smaller number is increased by 5, the sum will equal the
1. 1 answer
2. 540 views
how do u solve 3x=y-5
1. 1 answer
2. 246 views
what has the same slope but different y-intercept?
1. 1 answer
2. 338 views
Can anyone please show me and explain how to solve 9x+2=3y?Thanks,Bye.
1. 1 answer
2. 298 views
A compact car, mass 875 kg, moving south at 16 m/s, is struck by a full-sized car, mass 1660 kg, moving east at 12 m/s. The two
1. 0 answers
2. 1,114 views
Number the items to show the most effective and the least effective to use to scratch the mineral to test its hardness. Use
1. 2 answers
2. 487 views
According to the textbook,an individual's most. Important decision that will effect the climate is: a. The choice to unplug an
1. 1 answer
2. 413 views
if jay eats 1/3 of jelly beans and jack 1/4 of the jelly bean leveing bill with 10 jelly bean how many were there to start with
1. 2 answers
2. 422 views
Can anyone tell me 3 reasons why fracking is either good or bad and 3 supporting details?Please, thank you It's urgent
1. 2 answers
2. 529 views
Can anyone please share their idea of a strong, powerful hook, background information and thesis about fracking?Please this
1. 2 answers
2. 1,089 views
At the ocean's surface the pressure is 1 atmosphere. At 66 feet below seal level, the pressure is 3 atmosphere. The Relationship
1. 0 answers
2. 634 views
A software company started with 2 employees. In 6 months, the company had 14 employees. The number of employees increased at a
1. 1 answer
2. 764 views
Solve by drawing a diagram.A Tour bus travels 7 1/2 mi south, 3 1/2 east, 4 1/3 mi north, and 11 1/2 mi west. How far has the
1. 1 answer
2. 457 views
Calculate the heat of combustion of this wax in kJ/mol. How much energy is produced per carbon? What is the limiting reagent?I
1. 0 answers
2. 700 views
Johnny suffers from Flu an average of 5 times per week. However, Tony claims that Johnny rarely suffers from fewer than 15 bouts
1. 0 answers
2. 527 views
5.5 in long and 3.2 in wide must enlarge so that both dimensions are 1.8 times greater
1. 1 answer
2. 287 views
On Planet Y, the value of g is 12 m/s/s. If the human weighs 685 N on this planet, then how much woud he weigh on earth?
1. 1 answer
2. 403 views
If john must have a mark of 80% to past a test of 35 items, the number of items he may miss and still pass the test is
1. 2 answers
2. 1,866 views
The leader of a bicycle race is traveling with a constant velocity of +11.9 m/s and is 10.7 m ahead of the second-place cyclist.
1. 2 answers
2. 2,329 views
The grocery store sells kumquats for $4.25 a pound and Asian pears for $2.25 a pound. Write an equation in standard form for the
1. 2 answers
2. 4,638 views
1.an = 3n - 12. an = 2(2n - 3) 3.an = 4^n 4.an = (2/3)^n 5. an = (-1)^n(n + 5) 6. an = (-1)^n + 1(n + 6) 7. an= n+3/2n-1 8. a1 =
1. 1 answer
2. 1,181 views
A radio transmission tower is 170 feet tall. How long should a guy wire be if it is to be attached 7 feet from the top and is to
1. 2 answers
2. 1,521 views
Show the solutions of1. If a = 4, b = 3, and A = 36o. 2. If a = 3, b = 4, and A = 48.59o Finding a "solution" means solving for
1. 1 answer
2. 429 views
Window: [-4π , 4π , 1] [-10,10,1]State the Period, Amplitude, Phase Shift, Vertical Shift and Equation in cosine for #5 Number
1. 16 answers
2. 563 views
State the Period, Amplitude, Phase Shift, Vertical Shift, and equation (using cosine
1. 4 answers
2. 908 views
an = 3n - 1Answer 2, 3, 4, 5 2, 5, 8, 11 -2, -5, -8, -11 4, 7, 10, 13 3 points Question 2 Write the first four terms of the
1. 1 answer
2. 2,701 views
In 1983, the population of Functionville was 2560, and it tripled in 6 years.a. Write an exponential model for the population of
1. 4 answers
2. 1,334 views
Use the compound interest formulas A = P(1 + r/n)nt and A = Pe^rt to solve.Find the accumulated value of an investment of $3000
1. 1 answer
2. 799 views
1. The circumference of a circle is the product of the number π and twice the radius.2. The area of a square is the square of
1. 7 answers
2. 2,990 views
Question 1Write the first four terms of the sequence whose general term is given. an = 3n - 1 Answer 2, 3, 4, 5 2, 5, 8, 11 -2,
1. 7 answers
2. 6,925 views
What are your thoughts about overthinking and under thinking?
1. 2 answers
2. 1,049 views
Why is the asymptote of the function in Example #1 y=2 ? ( y = 4x+3 + 2 )
1. 1 answer
2. 676 views
f(x) = (x - 0.6)2 + .66. turn into h/k formwhat is the quadratic regression equation using your calculator
1. 0 answers
2. 455 views
Among all pairs of numbers whose difference is 88, find a pair whose product is as small as possible.
1. 3 answers
2. 1,164 views
In one U.S. city, the quadratic function models the median, or average, age, y, at which men were first married x years after
1. 1 answer
2. 1,130 views
A developer wants to enclose a rectangular grassy lot that borders a city street for parking. If the developer has 344 feet of
1. 1 answer
2. 734 views
farmer wants to enclose his pasture which is bordered by ariver. If he uses 750 feet of fencing on three sides of the field,
1. 1 answer
2. 630 views
If you toss a coin three times in a row, what is the probability of getting a head, a tail, and then a head?1/2*1/2*1/2= 0.125
1. 1 answer
2. 463 views
An object of mass 100 kg is suspended by two identical cables. The tension in cable one is (400i + 300j)N, where i and j are
1. 0 answers
2. 552 views
A cable weighing 2 lb/ft is 16 ft long. If a 20-lb weight is attached to the end, find the work done in winding up the chain.
1. 0 answers
2. 504 views
An electromagnetic wave strikes a 3.00-cm2 section of wall perpendicularly. The rms value of the wave's magnetic field is
1. 1 answer
2. 3,271 views
A particle of weight W is attached by a light inextensible string of length a to a point A on a verticle wall. The particle is
1. 0 answers
2. 570 views
A particle of mass 4kg is suspended from a point A on a vertical wall by means of a light inextensible string of length 130cm.A
1. 4 answers
2. 1,228 views
Why must all valves be open when an evacuation is performed?
1. 2 answers
2. 481 views
How many electrons are in oxide and in oxygen
1. 1 answer
2. 697 views
Find the coordinates of the x-intercept.2x + y = -6
1. 1 answer
2. 367 views
A pie chart of total number of students in a school has a sector 35degree representing 14students.how many students are there in
1. 2 answers
2. 986 views
Calculate the following:(a) mass of water in the hydrate sample (g): (b) number of moles of water in the sample: (c) mass of
1. 2 answers
2. 843 views
Mary has read 1/3 of a 240-page book. How many pages does she still have to read to finish the book? What percent of the book
1. 3 answers
2. 2,211 views
Why is it so important to know terms that are associated with all of thedifferent body systems even if you were to only work
1. 1 answer
2. 389 views
Please help me with question #2:How do you determine if there is a linear relationship between NaCO3 used and CO2
1. 0 answers
2. 545 views
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2, from my 12th grade
1. 1 answer
2. 806 views
I would really appreciate it if someone would please help me out with this lab, Stoichiometry by Loss of CO2,from my 12th grade
1. 1 answer
2. 692 views
Please help me with the questions at the end of this chemistry lab.Thank you for any help you can provide.1. This experiment
1. 1 answer
2. 631 views
find the coordinates of the circumcenter of tringleABCA(3,-1),B(-2,-1),C(3,-8)
1. 1 answer
2. 889 views
You are driving your car and the traffic light ahead turns red. you apply the breaks for 3.0 s, and the velocity of the care
1. 1 answer
2. 810 views
You are driving you car and the traffic light ahead turns red. you apply the breaks for 3.0s, and the velocity of the care
1. 1 answer
2. 504 views
What is the magnitude of the average acceleration of a skier who, starting from rest, reachers a speed of 8.0m/s when going down
1. 0 answers
2. 499 views
A box contains 1 white bow, 2 yellow bows, 3 red bows, and 6 green bows. The bows are all the same size and shape. If Patricia
1. 6 answers
2. 878 views
A researcher is interested in whether students who attend private high schools have higher average SAT Scores than students in
1. 2 answers
2. 866 views
A researcher is interested in whether students who attend private high schools have higher average SAT scores than students in
1. 1 answer
2. 1,297 views
Use elements in the order given to determine rows and columns of the matrix.R on {1,2,3,4} where aRb means |a-b| <1. R on
1. 2 answers
2. 407 views
The following DNA segment has one ORF. Do you know what it codes for?5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
1. 0 answers
2. 336 views
A woman drops a basketball, how far does it fall in one second? use formulas
1. 1 answer
2. 312 views
Legal Assistants typically work in a law office under the supervision of a/an: (Points: 5)attorney. freelancer. judge. legal
1. 1 answer
2. 528 views
Profits for a firm increase by lowering the firm’s __________ costs. (Points: 5)social judicial operating damage Is it
1. 1 answer
2. 442 views
Most management in large law firms is handled by: (Points: 5)judges. legal administrators. systems. contract employees Is it
1. 1 answer
2. 433 views
You are standing outside a closed door. On the other side of the door is a room that has three light bulbs in it. The room is
1. 1 answer
2. 1,341 views
U2 has a concert that starts in 17 minutes and they must all cross a bridge to get there. All four men begin on the same side of
1. 1 answer
2. 974 views
11. Write as a decimal.9% a.0.9 b. 0.09 c. 0.009 d. 9 i think its B
1. 1 answer
2. 937 views
Round to nearest hundred?483.9 a. 400 b. 484 c. 480 d. 500 I think its A
1. 2 answers
2. 650 views
Ownership rights that are associated with ownership of property include: (Points: 5)no rights at all. the right to lease it. the
1. 1 answer
2. 476 views
Rights that are associated with ownership of property and the effect that these rights may have on property are known as:
1. 1 answer
2. 906 views
Draw and describe the three overall redox reactions than occur in the conversionof 2,6-dimethylnitrobenzene to
1. 0 answers
2. 547 views
solve.0.7x+4<1.1x-7 -
1. 1 answer
2. 311 views
Globalization and global trade have led to increased competition in world markets and increased allocation of scarce resources.
1. 0 answers
2. 610 views
The heights of male students in a given university are normally distributed, with a mean of 70 inches and a standard deviation
1. 1 answer
2. 1,230 views
A machine has 7 identical components which function independently. The probability that a component will fail is .2. The machine
1. 2 answers
2. 642 views
The probability of an event can be negative, positive, or zero?
1. 1 answer
2. 340 views
If one of the 467 men is randomly selected, what is the probability of getting either an occasional smoker or a regular smoker?
1. 1 answer
2. 438 views
Can someone help me with this problem.When working with behavior disordered children in the classroom, the teacher aide can
1. 2 answers
2. 703 views
A psychological test was given to 92 teenage boys and 68 teenage girls. The test was used to assign a score to each teenager,
1. 1 answer
2. 505 views
Using 3(x-3)(x^2-6x+23)^1/2, as the chain rule differentiation of f(x)=(x^2-6x+23). Please explain how I find the general
1. 1 answer
2. 590 views
Please help with this question. I have a general solution to a differential equation of 18y^3/2= TOP LINE OF FRACTION is
1. 1 answer
2. 523 views

Pages

1
2
3
4
5

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025