Ask a New Question

Questions and answers by

Maria

Questions (939)

The accompanying table below shows the demand schedule facing a monopolist who produces at constan marginal cost of $5.Price
1. 0 answers
2. 762 views
A blue ball travelling at 2m/s hits a red ball at rest on a table. after they collide both balls move in the same direction.
1. 2 answers
2. 619 views
A blue ball travelling at 2m/s collides with a red ball at rest on a table. After they collide, both balls move in the same
1. 1 answer
2. 581 views
Write the equation of the ellipse using the given information:The ellipse has foci (–4, 0) and (–4, 4) and vertices (–4,
1. 1 answer
2. 602 views
Write the equation of the ellipse using the given information:The axis has lengths 2 and 5; the major axis is vertical; and the
1. 1 answer
2. 511 views
Write the equation of the ellipse using the given information:The ellipse has foci (4, 1) and (8, 1) and vertices (1, 1) and
1. 1 answer
2. 1,317 views
The perimeter of the larger table is 44 feet. what is the perimeter of the smaller table ?
1. 3 answers
2. 967 views
A charged cloud system produces an electric field in the air near Earth's surface. A particle of charge -2.1 x 10-9 C is acted
1. 0 answers
2. 1,068 views
120 inch length of ribbon is to be cut into three pieces. The longest piece is to be 40 inches longer than the shortest
1. 3 answers
2. 1,364 views
In most geometry courses, we learn that there's no such thing as "SSA Congruence" . That is, if we have triangles ABC and DEF
1. 0 answers
2. 1,258 views
How old is May,if Mary is two years older ,and Robert ,who is a year younger than Mary,will be ten next week?
1. 1 answer
2. 524 views
If Tom is taller than Mary ,and Mary is taller than Ann ,who was the shortest ?
1. 2 answers
2. 2,189 views
suppose that $2550 is invested in a saving account with a rate of 8.25%. how much interest will be received in 8 years?
1. 1 answer
2. 443 views
So this is a three part question. I solved the first part correctly but I need help with the second and third.Q: The
1. 2 answers
2. 2,441 views
Given: ΔABC, AB = BCPerimeter of ΔABC = 50 Perimeter of ΔABD = 40 Find: BD BD is the altitude and I got 15, 15+20+5=40
1. 8 answers
2. 4,018 views
Two poles of lengths 10 ft. and 15 ft. are set up vertically with their bases on horizontal ground 12 ft apart. Find the
1. 2 answers
2. 1,822 views
Deborah's father is twice as old she is now.if their ages add up to 45 years how old is Deborah.
1. 2 answers
2. 1,058 views
Maria ivanov has owned a successful clothing boutique chain for 20 years. Sha has gone into debt several times to expand her
1. 8 answers
2. 3,124 views
In which h economic situation would interest rate decrease?Most people are saving rather than buying houses••• Average
1. 17 answers
2. 5,391 views
A rocket is shot into the air with an initial velocity of 800m/sec. The equation h = -16t2+144t models the height of the ball.
1. 2 answers
2. 2,080 views
How much more pizza is in a 12-in. diameter pizza than an 8-in. diameter pizza?Round your answer to the nearest hundredth. Be
1. 1 answer
2. 653 views
You are shown a coin that its owner says is fair in the sense that it will produce the same number of heads and tails when
1. 0 answers
2. 655 views
On the scale drawing of a floor, plan A room is 7 in. long on the scale drawing. Find the actual length of the room.
1. 1 answer
2. 625 views
Calculate the mass of carbon monoxide that was needed to produce 78 grams of methanol by the following reaction:2H2+CO=CH3OH
1. 0 answers
2. 808 views
Determine the number of moles of sodium hydroxide produced when 2 moles of sodium and 3 moles of water react to form sodium
1. 1 answer
2. 1,406 views
Factor:2x^2 +13x-6 Please give step by step directions. I have tried doing it, but I can't get the right numbers. Thanks!
1. 1 answer
2. 433 views
A 23.7 kg child, with a 4.35 kg backpack on his back, first stands on a sidewalk and then jumps up into the air. Find the net
1. 0 answers
2. 665 views
Find the interior angles of the triangle with vertices (-4,1), (1,-6), and (5,-1)
1. 1 answer
2. 542 views
Hi,How do you know how many ligands a metal ion needs to form a complex ion? So for example, with (Fe(H20)6)2+, how am I
1. 1 answer
2. 582 views
kx^2-3k+5=0 find the solutions (roots)
1. 1 answer
2. 362 views
My sister is 8 years older than I am. The sum of our ages is 26. Find our ages
1. 2 answers
2. 1,575 views
6. What must a depositor add to a check before the bank will accept it for deposit?A. Cancel B. Void C. Endorsement D. Date of
1. 2 answers
2. 1,227 views
Pl help...what are the isomers of chlorodibromobenzene
1. 1 answer
2. 443 views
what are the isomers of chlorodibromobenzene
1. 1 answer
2. 679 views
What are the isomers of chlorobromobenzene
1. 1 answer
2. 525 views
If you reduce the distance between two point charges to one third of the original distance, the electromagnetic force changes by
1. 1 answer
2. 532 views
Rented an office and paid three months rent in advance to property Management check #001 $4,500. How would this journal entry be
1. 0 answers
2. 657 views
Invested $19,000cash in the business along with $6,000 of office equipment. How would this journal entry be posted to the
1. 1 answer
2. 623 views
Express the following in completed square form.x^2+4x-41
1. 1 answer
2. 412 views
how did the siege at the Alamo influence the response of the Texas settlers?it force them to recruit native Americans it forced
1. 6 answers
2. 2,919 views
A gas is used to fill a container up, there are 17.8 moles. What will be the new volume of the gas in the container at STP? (I
1. 2 answers
2. 520 views
Here are parts of the DNA base sequences for 7 organisms:Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
1. 1 answer
2. 882 views
Suzanne bought 50 apples at the apple orchard. She bought 4 times as many red apples as green apples. How many more red apples
1. 1 answer
2. 803 views
What are the joules needed to melt 50.0g of ice at 0 degree C and to warm the liquid to 65.0 degree C?
1. 0 answers
2. 578 views
A chemist reacted 0.05 mol of sodium with water to form 50cm3 of sodium hydroxide what was the mass of sodium reactedNa+h2p-Noah
1. 2 answers
2. 614 views
I walked 2/7 of a mile in 4/9 of an hour. at this rate, how far will I have traveled after an hour?
1. 1 answer
2. 319 views
1. Which activity is part of both private and civic life? (1 point)learning about politics •• voting for a candidate going
1. 22 answers
2. 7,810 views
Of the following choices which ones are considered democratic values? Select all that applyA. Serving in the military*** B.
1. 9 answers
2. 2,291 views
Identify and interpret the decay factor for each of the following.a.) P= 400×(0.43)^t decay factor: 0.43 This means that the
1. 1 answer
2. 519 views
Need these answered soon please!10. The author of “My Brother’s Keeper” emphasizes Jamie’s conflict by describing the
1. 6 answers
2. 5,298 views
The revenue for a sale of x books at $80 each is given by R(x) = 80x. The commission for a revenue of x dollars is givenby C(x)
1. 1 answer
2. 449 views
how does the president limit the legislative power of congress.a- by appointing congressional committee chairs b- by
1. 3 answers
2. 1,410 views
1. At which meeting was Georgia not represented? A.) Provincial CongressB.) First Continental Congress C.) Second Continental
1. 2 answers
2. 1,216 views
write a program that takes an integer n and output the largest odd divisor of n
1. 0 answers
2. 468 views
Dr. Bob222I still didn't understand which is the reduction half reaction and its products and oxidation half reaction...and why
1. 1 answer
2. 822 views
Please help...entrance exam soonWrite the oxidation and reduction half reactions(showing e- lost or gained) for the foll O3 + I-
1. 1 answer
2. 444 views
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the
1. 2 answers
2. 1,179 views
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the
1. 2 answers
2. 885 views
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.
1. 1 answer
2. 437 views
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.
1. 1 answer
2. 494 views
Talking the talk emphasizes the use of lableing individuals positivly
1. 1 answer
2. 848 views
CHCl3 + MnO4- = Cl2 + CO2 + Mn+2Balance the above with half reactions in acidic medium. For the above reaction, can you please
1. 1 answer
2. 1,309 views
BALANCE THE REDOX REACTION USING HALF CELL METHOD IN AN ACIDIC MEDIUMCHCl3 + MnO4- = Cl2 + CO2 + Mn+2
1. 1 answer
2. 995 views
Half reaction method of balancing redox reactionCHCl3 + MnO4- = Cl2 + CO2 + Mn+2
1. 0 answers
2. 969 views
24 dogs line up for breakfast. The first cat eats one fish, the second cat eats two fish, and so on, with each cat eating one
1. 1 answer
2. 578 views
a) What is fellesioneffekten?Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a
1. 0 answers
2. 533 views
a) What is fellesioneffekten?Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a
1. 2 answers
2. 552 views
In quality control of raw materials for pharmaceutical production often used foul reactions to prove that raw materials in salt
1. 0 answers
2. 594 views
Cocaine is a weak base (Figure see below) with pKb = 5.59. Cocaine has local anesthetic effect (local anesthetic) but is also a
1. 0 answers
2. 804 views
To create a 0.1 M carbonate buffer pH = 10.2. You choose to use a combination of HCO3- / CO32-. This buffer system has pKa =
1. 0 answers
2. 855 views
a) Hva er fellesioneffekten?Veronal er et barbiturat (struktur se over). Barbiturater er en stoffklasse som forekommer i en
1. 0 answers
2. 584 views
Calculate the pH reaches 30.0 mL one 0.200 M solution of HCl salt of amitriptyline is added 100.0 mL of a NaOH solution of
1. 0 answers
2. 444 views
Calculate the pH at 25 ° C when 120 mL of a HCl solution having a concentration of 50 mM is added 50.0 mL of a 120 mM ephedrine
1. 0 answers
2. 456 views
presentation Tasks:Ephedrine (structure see below) is a natural product that is used as a medicine in the treatment of asthma.
1. 0 answers
2. 507 views
Ahmed says that there are 70 sweet in the box to the nearest 10 what is the least number of sweets that could be in the box
1. 1 answer
2. 358 views
A plane setts off from airport A and flies due east for 100 km, then turns to fly due south for 80 km before landing at an
1. 1 answer
2. 766 views
Which of these words best describes a merchant?A. Explorer B. Middleman C. Monarch D. Slave I have having trouble between
1. 2 answers
2. 1,032 views
What do you do when you have for sale factor 0.5 and 0.25
1. 1 answer
2. 343 views
The small circle and the large circle have the same center O. Chord AB is tangent to the smaller circle at C. Prove that the
1. 1 answer
2. 776 views
Assuming all gases are at the same temperature and pressure, how many milliliters of hydrogen gas must react to give 41.0 mL of
1. 1 answer
2. 713 views
A typical antacid contains CaCO3. If such an antacid is added to 25.0 mL of a solution that is 0.250 M in HCl, how many grams of
1. 1 answer
2. 828 views
Suppose the counts recorded by a Geiger counter follow a Poisson process with an average of two counts per minute. Round the
1. 0 answers
2. 1,099 views
A survey showed that 36% of car owners prefer two door cars, 52% prefer four door cars, and 12% have no preference. You ask 300
1. 9 answers
2. 3,129 views
the probability of winning a game is 25%. how many times should you expect to win if you play 20 times.
1. 18 answers
2. 3,997 views
from a barrel of colored marbles, you randomly select 5 blue, 2 yellow, 3 red, 4 green, and 2 purple marbles. Find the
1. 9 answers
2. 2,190 views
How test tube babies are born?
1. 1 answer
2. 341 views
I need help with my introduction and topics for my five paragraph essay on why the stamp act was not fair.
1. 5 answers
2. 458 views
Find the formula for a function of the form y=bxe^(-ax) with a local maximum at (4,12)...
1. 1 answer
2. 3,194 views
Suppose we observe the following rates: 1R2= 8%, 1R2= 10%. If the unbiased expectations theory of the term structure of interest
1. 1 answer
2. 1,207 views
A hockey team can win, lose, or tie a match. It gets 2 points for a win, 0 points for a loss, and 1 point for a tie. It has lost
1. 1 answer
2. 714 views
What did the Vogel's artworks communicate about their historical interests?They collected works that were culturally popular.
1. 24 answers
2. 4,410 views
Beta has a rope 23m long. She cutis off 1/5 of it.How long are the two pieces
1. 2 answers
2. 312 views
4. Which one of the following philosophies makes every employee a quality inspector for his or her own work?A. Six sigma C.
1. 3 answers
2. 1,129 views
10. Which statement is most accurate regarding reinforcement theory?A. Attainable goals lead to high levels of motivation under
1. 4 answers
2. 1,497 views
I have 5 more red pins than yellow pins and 8 more yellow pins than green pins. The green pins are 3 centimeters shorter than
1. 1 answer
2. 273 views
Equilibrium involving SO2(g), O2(g) & SO3(g) is important in sulfuric acid production. When a 0.0200 mol sample of SO3 is
1. 2 answers
2. 989 views
Which factor contributed to growing conflict over slavery from the 1820s through the 1850s?falling crop prices rapid
1. 6 answers
2. 2,422 views
I need to solve this inequality:3(x-1)^2 > 0 The answer is x �‚ 1, but I don't understand why the answer is not allowed to be
1. 3 answers
2. 400 views
An unknown radioactive substance has a half-life of 124 years. How long will it take a 67 grams sample to degrade to 18 grams?
1. 1 answer
2. 1,005 views
which question would best help you analyze the population density of north korea? You have to choose 3 correct answers.How many
1. 13 answers
2. 1,189 views

Pages

1
2
3
4
5
6
7
8
9
10

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025