Ask a New Question

Questions and answers by

Jessica

Questions (1,739)

Joanie wants to mail a package that requires $1.30 in postage. If she has only 5-cent and 7-cent stamps, what is the smallest
1. 1 answer
2. 1,469 views
a turtle is at the bottom of a 11 foot well. each day it crawls up 5 feet, but each night it slips back 3 feet. after how many
1. 1 answer
2. 990 views
At the start of the process 118 kg of isobutylbenzene is used and the overall yield of the 3 reaction steps is 24%, how many 400
1. 2 answers
2. 590 views
Choccamine and mintanol have Rf values of 0.81 and 0.21 respectively. What would the distance in centimetres (cm) between the
1. 1 answer
2. 605 views
Who did Lincoln command as the first "General of the Union army"
1. 1 answer
2. 555 views
Would knowledge be considered a theme in Anthem by Ayn Rand?
1. 1 answer
2. 519 views
A 94 mL vanillin solution with a concentration of 0.017 mol L-1 was made by extraction from 24.41 g of vanilla pods. Calculate
1. 7 answers
2. 503 views
We had a chart from A-Z for Anthem by Ayn Rand. For each letter much be at least rhetorical device or a mood or tone. I need
1. 1 answer
2. 532 views
Consider the reaction:M + 2HCl �¨ MCl2 + H2 When 0.85 mol of the metal, M, reacted with an aqueous HCl solution (the HCl is in
1. 3 answers
2. 3,390 views
What are some analogies in Anthem by Ayn Rand from chapters 9-12
1. 1 answer
2. 697 views
At 34 degrees north latitude, the longest day of the year has 14.273 hours of daylight, and the shortest day 9.726 hours. If the
1. 0 answers
2. 629 views
1.0<x<1. Which must be true?I. x^9 < x^7 II.x^7+x^5 < x^6+x^4 III. x^7-x^5 < x^6-x^4 2. A football team average x points (the
1. 0 answers
2. 420 views
Determine the pH of a solution of 12.00 mL of 0.2 M acetic acid with 10 mL of a 0.025M NaOH? (Ka = 1.8E–5)I've calculated my
1. 3 answers
2. 434 views
Okay so in our class we did an ice cream lab where we use Ziploc bags to make ice cream. We made an ice cream mixture and then
1. 2 answers
2. 655 views
If 0.605 g of magnesium hydroxide reacts with 1.00g of sulfuric acid, what is the mass of magnesium sulfate produced?Mg(OH)2(s)+
1. 1 answer
2. 1,747 views
When you approach a text, you shouldA. survey it, using the technique called SQ3R. B. dive right in at the first page and read
1. 1 answer
2. 728 views
The electrophoresis of a mixture of histidine (His), aspartic acid (Asp) and phenylalanine (Phe) is carried out at a pH of 5.91.
1. 2 answers
2. 810 views
The electrophoresis of a mixture of histidine (His), aspartic acid (Asp) and phenylalanine (Phe) is carried out a pH of 5.91.
1. 1 answer
2. 576 views
An aqueous solution of a monoprotic acid is prepared. This acid is known to have a pKa of 8.6. If the acid is 37.5% ionized when
1. 2 answers
2. 749 views
How do you write a graph to represent the functionx=0,1,2,3 y= 1,4,7,10
1. 1 answer
2. 333 views
What is the funtion rule shown in the tablen 3,4,5,6 y 2,1,0,-1
1. 1 answer
2. 470 views
calculate oh- and ph in a solution in which dihydrogen phosphate ion is 0.335 M and hydrogen phosphate is 0.335 M.This is a
1. 2 answers
2. 1,432 views
You are making a fence for your garden. The length is five less that two times the width. A.write a polynomial that represents
1. 1 answer
2. 1,219 views
Kool Klothes has determined that the revenue function for selling x thousand pairs of shorts is R(x) = -5x^2 + 21x. The cost
1. 2 answers
2. 1,422 views
There is a picture of a brick lying face down and one standing straight up. The question asks: Is each brick exerting the same
1. 2 answers
2. 644 views
This 23 year old female is brought into the emergency department after being found by her collage roommate. Sometimewithin the
1. 1 answer
2. 949 views
At 500 degrees celsius, K for the formation of ammonia from nitrogen and hydrogen gases is 1.5x10-5.N2(g)+3H2(g)->/<-2NH3(g)
1. 5 answers
2. 1,224 views
Calculate the activity of KI, x, in the following electrochemical cell ifthe potential is +0.294 V Ag | AgCl(s),NaCl(aq,0.1)
1. 1 answer
2. 914 views
Plane A leaves the airport. One hour later, Plane B leaves the same airport on the same course. It catches up to Plane A in 2.5
1. 2 answers
2. 2,565 views
A certain reaction has an activation energy 52.93 kJ/mol. At what kelvin temperature will the reaction proceed 8.00 times faster
1. 1 answer
2. 577 views
Two rectangular blocks are stacked on a table. The upper block has a mass of m2 and the lower mass is m1 > m2. The coefficient
1. 0 answers
2. 794 views
At & T has a cell phone plan of $25.00 a month plus 30 cents per minute. There is a one year contract wit a new phone for $19.99
1. 1 answer
2. 560 views
Light from three different lasers (A, B, and C), each with a different wavelength, was shined onto the same metal surface. Laser
1. 7 answers
2. 3,275 views
A reaction proceeds with ∆ H = 40 kJ/mol. The energy of activation of the uncatalyzed reaction is 120 kJ/mol, whereas i t is
1. 0 answers
2. 960 views
You have a subject (height = 150 cm, mass = 85 kg) lying prone on a moment table with their feet pressed against the foot rest.
1. 0 answers
2. 504 views
How did Deism, the Second Great Awakening, continued denominational fragmentation, and Mormons shape American religious life?
1. 1 answer
2. 895 views
There is a state soccer tournament with 128 teams competing for 1st place. Each week, half of the teams get eliminated. How many
1. 1 answer
2. 1,109 views
A solution of 0.200M NaOH (14.0 mL) is mixed with 42.4 mL of 0.170M HNO3. Assuming the final volume is the sum of the initial
1. 1 answer
2. 592 views
A solution of 0.200M NaOH (14.0 mL) is mixed with 42.4 mL of 0.170M HNO3. Assuming the final volume is the sum of the initial
1. 1 answer
2. 587 views
Let y = integrate from 1-9x to 1 of (u^3)/(1+u^2)What is y'? I flipped the integral so it's 1 to 1-9x and had the derivative of
1. 2 answers
2. 371 views
Can you help me annotate this prompt? I don't know really how to do it?In the following passage from the scarlet letter the
1. 3 answers
2. 900 views
Given an interest rate of 6.25% compounded annually, how much would you accumulate if you started with $3,250 and then
1. 0 answers
2. 668 views
Given an interest rate of 6.25% compounded annually, how much would you accumulate if you started with $3,250 and then
1. 1 answer
2. 535 views
f(x)=-x^2 - 3xFind the axis of symmetry, vertex, direction it opens, and write the equation in vertex form. If f(x) =x^2 + 2x
1. 1 answer
2. 637 views
Benzene has a vapor pressure of 183 mm Hg at 40 degrees Celsius. Taking it's heat of vaporization to be 30.8 kJ/mol, calculate
1. 1 answer
2. 1,715 views
Chapter 23 and. 241. "Within the church, it had hardly been kept down; beneath the sky, it pealed upward to the zenith" is an
1. 4 answers
2. 1,537 views
A 447.5-N force accelerates a go-cart and its driver from 10.3 m/s to 16.7 m/s in 4.01 s. What is the mass of the go-cart plus
1. 1 answer
2. 580 views
Chapter 24 Scarlet letter Please tell me if these are correct or notThe narrator characterizes Chillingworth by means of A. An
1. 1 answer
2. 2,043 views
Can you check my answers to see if they are right and if not, help me on it?These questions begin with the paragraph starting
1. 1 answer
2. 1,730 views
A physical pendulum is constructed of a 48 cm long piece of wooden dowel with a mass of 550 grams and a radius of 0.7 cm.
1. 1 answer
2. 593 views
A 100N force acting on a lever 2m from the fulcrum balances an object 0.5m from the fulcrum on the other arm. What is the weight
1. 4 answers
2. 3,540 views
the length of a rectangular mirror is 12 cm longer than its width. find its dimensional if its perimeter is 60cm.
1. 3 answers
2. 514 views
Feminists argue that since the past millennium in the West have been dominated by men-whether they be politicians in power or
1. 3 answers
2. 501 views
Even though they are good friends, what is one argument seen in the play "The Night Thoreau Spent in Jail" between Henry and
1. 3 answers
2. 1,160 views
(I just need 2 writer ideas)In the middle of the 19th century, political philosopher Alexis de Tocqueville claimed, "The
1. 12 answers
2. 5,603 views
What is the social context in Edgar Allan Poe’s story, “A Tell-tale heart.”
1. 3 answers
2. 1,031 views
Suppose the current interest rate is 12 percent and a bond with a face value of $500 thatpays a coupon rate of 15 percent is
1. 0 answers
2. 511 views
A 6pack of undershirtsome cost $13.98. This is $3.96 less than the cost of buyingas 6 individual shirts. If each undershirt
1. 2 answers
2. 449 views
Cu++ forms a blue-green complex with tetraphenylporphin in a 1:1 ratio. Say you have 100 mL of a 2.0 x 10^-4 solution of the
1. 1 answer
2. 504 views
A particle moves along line segments from the origin to the points (3, 0, 0), (3, 3, 1), (0, 3, 1), and back to the origin under
1. 3 answers
2. 6,642 views
A sample of oxygen gas occupies a volume of 3.84 L at 269. K. What volume will the sample occupy at 486. K?
1. 1 answer
2. 528 views
Sodium chloride has properties that are very similar to those of sodium.True or False
1. 3 answers
2. 914 views
In the following reaction, how many liters of carbon dioxide will be produced if 250 liters of oxygen is used in the combustion
1. 3 answers
2. 1,395 views
When did these scientists make their contributions ? The yearsDemocritus believes that the universe was made of tiny uncuttable
1. 1 answer
2. 560 views
How would you describe someone who keeps blaming someone or something for something tragic and believes that person was
1. 0 answers
2. 558 views
What character trait do you think this quote shows of the narrator in Annabel Lee?The angels, not half so happy in Heaven, Went
1. 1 answer
2. 1,156 views
3. Given the following information for Janicek Power Co., find the WACC. Assume the company’s tax rate is 35%.Debt: 8,500 7.2%
1. 2 answers
2. 1,349 views
A woman wishes to invest $12,500 in three types of bonds: municipal bonds paying 8% interest per year, bank investment
1. 0 answers
2. 739 views
A confectioner sells two types of nut mixtures. The standard-mixture package contains 100 g of cashews and 200 g of peanuts and
1. 1 answer
2. 1,626 views
Genome A5�-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC
1. 0 answers
2. 667 views
68.0g of solute were dissolved in 393 mL of benzene. The solution froze at -0.50°C. The normal freezing point of benzene is
1. 1 answer
2. 618 views
In a routine laboratory analysis, a solution of sodium chromate with a chromium concentration of 175.0 ppm is required.
1. 1 answer
2. 451 views
What is an example of morbidity in "The Fall Of the House of Usher" by Edgar Allan Poe ? I know what morbidity is but it's hard
1. 1 answer
2. 660 views
In an experiment I used .139 grams of an Alka Selzter table. A question asks us to determine the amount of CO2 dissolved in
1. 1 answer
2. 387 views
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the
1. 0 answers
2. 999 views
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the
1. 2 answers
2. 2,067 views
What tense is this verb ?The state police were pulling over many drivers? I think its past progressive but i don't know if it
1. 1 answer
2. 806 views
What is the purpose of Annabel Lee by Edgar Allan Poe?What are some qualities and Character traits about of the Speaker in
1. 2 answers
2. 1,403 views
What is moral lesson in Annabel Lee?
1. 2 answers
2. 2,360 views
The maker of an automobile advertises that it takes 11 seconds to accelerate from 15 kilometers per hour to 90 kilometers per
1. 1 answer
2. 984 views
why do we use the limiting reactant data to calculate delta h?why might it be important to know delta h prior to running a
1. 1 answer
2. 3,232 views
2 SO2(g) + O2(g) <==> 2SO3(g)Initially, 1.6mol SO3 is placed in a 3.0L container. At equilibrium, [O2] = 0.15M. What is the
1. 4 answers
2. 1,435 views
Consider the following equilibrium system at 900°C:H20(g) + CO(g) <==> H2(g) + CO2(g) Initially 5.0 moles of H2O and 4.0 moles
1. 2 answers
2. 1,360 views
Maria has 24ft of fence.she wants to make the lalgest rectangular area possible for her dog.what length should she make each
1. 1 answer
2. 453 views
How do I solve this using the Quadratic formula and finding the determinant?1. 5x-6=0 2. x+25=0
1. 2 answers
2. 415 views
I know this sounds dumb, but what do you call people who are rich but they act normal, don't try to show off at all, and is very
1. 3 answers
2. 630 views
BoxedNGone truck rentals calculates that its price function is p(x)=160-2x,where p is the price (in dollars) at which exactly x
1. 1 answer
2. 3,642 views
What part of speech is the infinitive phrase used? Is this a noun, adjective, or adverb?1. The coach's example is one to take
1. 6 answers
2. 1,418 views
You are measuring walnuts for banana walnut oatmeal and a spinach and walnut salad. You need 3/8 cup of walnuts for the oatmeal
1. 4 answers
2. 1,185 views
A piece of copper of mass 21.3 g at 106.0 °C is placed in a vessel of negligible heat capacity but containing 53.0 g of water
1. 1 answer
2. 708 views
Determine the exact radian measure for each angle.40 degrees.
1. 1 answer
2. 523 views
Find all relative extrema. Use the Second Derivative Test where applicable.f(x)= cosx - x (0,2ð)
1. 2 answers
2. 1,180 views
Calculate the enthalpy change for:C2H4(g) + H2 --> C2H6(g) delta Hrxn: H2(g) + 1/2O2 --> H2O (l) C2H4(g) + 3O2 --> 2H20(l) +
1. 2 answers
2. 3,416 views
A volleyball is launched straight up at an initial velocity of 2.3 m/s. It is then spiked by a taller player 0.8 meters above
1. 1 answer
2. 683 views
When evolution was first proposed, which of the following was used as evidence to support the idea?1.observations of nature
1. 1 answer
2. 1,840 views
What is the quotien of 148 ➗32 ? Help I need it now
1. 1 answer
2. 397 views
I need help with writing an essay about simple questions, complicated questions, and complex questions. I need to make a topic,
1. 1 answer
2. 754 views
Which one of the following is a geometric sequence?A. 2, –3, 9⁄2, −18⁄4 B. 0,1,2,3,... C. 8,4,2,1,1⁄2,1⁄4,... D.
1. 2 answers
2. 552 views
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of
1. 1 answer
2. 572 views
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of
1. 1 answer
2. 671 views

Pages

1
2
3
4
5
6
7
8
9
10

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025