if one strand of dna

During protein synthesis, an RNA strand is transcribed from one strand of DNA that reads:GCG TTA CCT What is the complementary
1. 1 answer
2. 20 views
Use the drop-down menus to order the steps involved in protein production.The strand of RNA moves to the ribosome. The DNA
1. 1 answer
2. 20 views
Transcription results in:(1 point)Responses a protein a protein a new DNA strand a new DNA strand an mRNA strand an mRNA strand
1. 1 answer
2. 93 views
Which of the following would be most likely to cause a mutation?A. the addition of nucleotides to the 3' end of the growing
1. 1 answer
2. 78 views
BONUS: ATGCCCCCGAGAAGCCCTTAGIn the space below, provide the following: 1.) Replicated DNA strand 2.) Transcribed RNA strand 3.)
1. 1 answer
2. asked by wishin i was fishin ( im a girl okay everyone think ima boy from my name)
3. 117 views
2. Write down the DNA strand which is complementary to the strand shown below. Be sure to mark the ends of your strand
1. 1 answer
2. 51 views
If the chromatids involved in each of two crossovers are independent, what is the expected ratio of two-strand : three-strand :
1. 0 answers
2. asked by Jamie
3. 582 views
Many nucleotides linked together create a strand of DNA. One strand of DNA isbound to a second strand of DNA by _______ bonds.
1. 1 answer
2. 20 views
Which statement best explains how genetic mutations produce genetic variation?(1 point)Responses A strand of DNA is translated
1. 1 answer
2. 7 views
Which statement best explains how genetic mutations produce genetic variation?(1 point)Responses A strand of DNA is translated
1. 1 answer
2. 14 views