Ask a New Question

if a start codon changes

Which of the following is true of a start codon?UGG is the start codon. The start codon is the three-base sequence that signals
1. 1 answer
2. asked by Dontillia
3. 61 views
If there's 4 nucleotides, what is the probability to get a start codon ?If I understand correctly; a codon = 3 nucleotides, so
1. 0 answers
2. asked by Anonymous
3. 528 views
Below is a codon - amino acid chart. The chart is read from the inside out. Please watch the video above if you need a reminder
1. 1 answer
2. 61 views
Below is a codon - amino acid chart. You read the chart from the inside out. Review this video for a reminder of how to read a
1. 1 answer
2. 134 views
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
2. asked by ISSY
3. 501 views
if a start codon changes into a stop codon, how would this effect transcription? please help.
1. 1 answer
2. asked by Sara
3. 448 views
Which statement correctly describes the structure of a codon? (1 point)A codon is a sequence of chromosomes. A codon is a
1. 1 answer
2. 262 views
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
2. asked by Sonya
3. 616 views
if you being with a strand of dna 21 nucleotides long it will be transcribed by ___into a strand containing ___ codons. if it
1. 1 answer
2. 48 views
Using the codon table, determine the sequence of the protein that will be produced from themRNA sequence below. Be sure to begin
1. 1 answer
2. asked by Mariana
3. 844 views