Ask a New Question

Which term describes parts of an organism that have a

The list describes examples of several ways organisms obtain energy:Organism A eats other living things for food. Organism B
1. 1 answer
2. asked by terrance
3. 24 views
Here are parts of the DNA base sequences for 7 organisms:Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
1. 1 answer
2. asked by Maria
3. 864 views
A scientist discovered a microscopic, unicellular organism with no nucleus. Which of the following correctly describes the
1. 8 answers
2. asked by 56ty
3. 5,569 views
Which statement describes a consumer/producer relationship?A. One organism eats another organism that makes its own food B one
1. 1 answer
2. 61 views
Which term describes parts of an organism that have a similar structure but a different function?Vestigial structure
1. 1 answer
2. asked by 22
3. 212 views
Which term describes parts of an organism that have a similar structure but a different function?1 Vestigial structure 2
1. 1 answer
2. asked by good grades
3. 196 views
Which statement describes a consumer/producer relationship?Both organisms benefit from each other. One organism that benefits
1. 7 answers
2. asked by ronaldo is better then messi
3. 100 views
A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following
1. 17 answers
2. asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
3. 3,763 views
Which statement describes a consumer/producer relationship?A. One organism eats another organism that makes its own food. B. One
1. 1 answer
2. asked by Help
3. 77 views
Which statement describes a consumer/producer relationship?A. One organism eats another organism that makes its own food. B. One
1. 3 answers
2. asked by 🧀 Cheesy-Mc-cheeserson 🧀
3. 96 views