18.Create your own strand of

Many nucleotides linked together create a strand of DNA. One strand of DNA isbound to a second strand of DNA by _______ bonds.
1. 1 answer
2. 20 views
Which of the following is an example of a mutation?Responses A A nucleotide is missing in a replicated DNA strand.A nucleotide
1. 1 answer
2. 55 views
During protein synthesis, an RNA strand is transcribed from one strand of DNA that reads:GCG TTA CCT What is the complementary
1. 1 answer
2. 20 views
1 of 101 of 10 Items00:29 Skip to resources Question Which of the following is an example of a mutation? Responses A A
1. 1 answer
2. 67 views
Use the drop-down menus to order the steps involved in protein production.The strand of RNA moves to the ribosome. The DNA
1. 1 answer
2. 20 views
Transcription results in:(1 point)Responses a protein a protein a new DNA strand a new DNA strand an mRNA strand an mRNA strand
1. 1 answer
2. 93 views
Polymerase is a vital enzyme during DNA replication as it adds new nucleotides to the DNA strand. It identifies the original DNA
1. 1 answer
2. 122 views
Which of the following would be most likely to cause a mutation?A. the addition of nucleotides to the 3' end of the growing
1. 1 answer
2. 78 views
BONUS: ATGCCCCCGAGAAGCCCTTAGIn the space below, provide the following: 1.) Replicated DNA strand 2.) Transcribed RNA strand 3.)
1. 1 answer
2. asked by wishin i was fishin ( im a girl okay everyone think ima boy from my name)
3. 117 views
2. Write down the DNA strand which is complementary to the strand shown below. Be sure to mark the ends of your strand
1. 1 answer
2. 51 views