Once the DNA strand is transcribed, the mRNA strand is sent out of the nucleus to ribosomes for translation. What would most likely occur at letter D, as the mRNA strand moves along the ribosome complex?

Responses
A tRNA molecules attach to the ribosome and start to degrade.tRNA molecules attach to the ribosome and start to degrade.
B tRNA molecules carrying amino acids start aligning with the mRNA codons.tRNA molecules carrying amino acids start aligning with the mRNA codons.
C tRNA molecules start the replication process inside the ribosome.tRNA molecules start the replication process inside the ribosome.
D tRNA detaches from amino acids and exits the ribosome.

1 answer

The correct response for what would most likely occur at letter D, as the mRNA strand moves along the ribosome complex, is:

B: tRNA molecules carrying amino acids start aligning with the mRNA codons.

During translation, tRNA molecules bring specific amino acids to the ribosome based on the codons of the mRNA strand. Each tRNA has an anticodon that complements the mRNA codon, allowing the correct amino acid to be added to the growing polypeptide chain. Responses A, C, and D do not accurately describe the process occurring during translation at this stage.

Similar Questions
    1. answers icon 1 answer
    1. answers icon 1 answer
  1. Transcription results in:(1 point)Responses a protein a protein a new DNA strand a new DNA strand an mRNA strand an mRNA strand
    1. answers icon 1 answer
  2. BONUS: ATGCCCCCGAGAAGCCCTTAGIn the space below, provide the following: 1.) Replicated DNA strand 2.) Transcribed RNA strand 3.)
    1. answers icon 1 answer
more similar questions