To answer your question, let's translate the given cDNA sequence into amino acid codes first and then consider the scenarios you mentioned:
The given cDNA sequence is:
ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT
To translate this sequence into amino acid codes, we need to break it down into codons - which are groups of three nucleotides that represent a specific amino acid. Here's the translation:
ATG - initiator (methionine)
TTC - phenylalanine
AAT - asparagine
GTT - valine
ATG - methionine
GGA - glycine
TTG - leucine
CCT - proline
GGT - glycine
AAA - lysine
TGA - stop codon (terminating sequence)
Now, let's consider the scenarios you mentioned:
1. If there is a C deletion in the phenylalanine codon (TTC):
In this case, the codon becomes TTA, which codes for leucine. Therefore, the translation would be:
ATG - initiator (methionine)
TTA - leucine
AAT - asparagine
GTT - valine
ATG - methionine
GGA - glycine
TTG - leucine
CCT - proline
GGT - glycine
AAA - lysine
TGA - stop codon (terminating sequence)
2. If there is an A insertion in the phenylalanine codon (TTC) in any of the frames:
Inserting A in the middle of the codon would cause a frame shift in the translation process, resulting in incorrect amino acid coding for the subsequent codons. As a result, the remaining amino acid codes would likely be different from the original sequence, making it challenging to provide a hypothetical translation.
Please note that these hypothetical translations are based on the assumptions you provided and may not reflect actual biological processes.