The sequence below begins with the initiator methione.

ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT
Please give a hypothetical (translation of cDNA sequence into single
amino acid codes if there is a C deletion in the phenylalanine codon

_4pts.(Please give a hypothetical translation of cDNA sequence into single
Amino acid codes if there is an A insertion in the phenylalanine codon any of the frames_

Similar Questions

a sequence begins -4,1,6,11find the rule that generates the sequence. Then give the 5oth term is the sequence. What type of
1. 1 answer
a sequence begins -4,1,6,11find the rule that generates the sequence. Then give the 5oth term is the sequence. What type of
1. 0 answers
a sequence begins -4,1,6,11 find the rule that generates the sequence. Then give the 5oth term is the sequence. What type of
1. 1 answer
Someone has just given you the cDNA for GFP and you would like to design a construct that would result in GFP becoming resident
1. 0 answers