Question

The sequence below begins with the initiator methione.
ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT
Please give a hypothetical (translation of cDNA sequence into single
amino acid codes if there is a C deletion in the phenylalanine codon

_4pts.(Please give a hypothetical translation of cDNA sequence into single
Amino acid codes if there is an A insertion in the phenylalanine codon any of the frames_