sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids that would be formed from N-terminus to C-terminus.

Answer 1

use the universal triplet code to determine the sequence of amino acids that would be generated for mrna sequence 5'atggatgaaacgggctaggua3'

Answer 2

I DON't CARE