Asked by Nghia

sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids that would be formed from N-terminus to C-terminus.

13 years ago

Answered by tabitha

use the universal triplet code to determine the sequence of amino acids that would be generated for mrna sequence 5'atggatgaaacgggctaggua3'

11 years ago

Answered by L

I DON't CARE

3 years ago

There are no AI answers yet. The ability to request AI answers is coming soon!

Submit Your Answer

We prioritize human answers over AI answers.

If you are human, and you can answer this question, please submit your answer.

Asked by Nghia

Answers

Submit Your Answer

Related Questions