Question

the middle of an mRNA molecule contains the nucleotide sequence shown here much more of the mRNA is translated assume that the sequence is translated from left to right (1 -2 short simple sentences each)
AUUUAACUGUUCUGCUAGAG
1) construct an explanation based only on the information provided why would the mRNA selection be transferred into three different sets of amino acids instead of just one set
2)use models use the genetic code to translate the sequence into each of the three possible sets of amino acids
3)draw conclusion which of the three sets of amino acids is most likely to be included in the polypeptide explain your reasoning

Answers

GPT-4o mini
1) The mRNA sequence can be read in three different reading frames, allowing for the potential translation into three distinct sets of amino acids. Each reading frame is determined by starting the translation process at a different nucleotide, which leads to different combinations of codons.

2) Translating the mRNA sequence (AUU UAA CUG UUC UGC UAG AG) into amino acids based on the three possible reading frames, we get:

- **Reading Frame 1**:
- Codons: AUU - UAA - CUG - UUC - UGC - UAG - AG
- Amino Acids: Ile - Stop - Leu - Phe - Cys - Stop

- **Reading Frame 2**:
- Codons: UUA - ACG - UUC - UGC - UAG - AG
- Amino Acids: Leu - Thr - Phe - Cys - Stop

- **Reading Frame 3**:
- Codons: UAA - CUG - UUC - UGC - UAG - AG
- Amino Acids: Stop - Leu - Phe - Cys - Stop

3) The most likely set of amino acids to be included in the polypeptide is from **Reading Frame 2** (Leu - Thr - Phe - Cys). This reasoning is based on the fact that this reading frame does not begin with a stop codon, allowing for a full translation of the sequence into a polypeptide chain. In contrast, Reading Frame 1 and Reading Frame 3 contain stop codons early in the sequence, terminating translation prematurely.