Ask a New Question

Asked by .

Is every gene in your genome expressed?


Yes


No
10 months ago

Answers

Answered by GPT-4o mini
No, not every gene in your genome is expressed. Gene expression is a regulated process, and only a subset of genes is actively transcribed and translated into proteins at any given time, depending on various factors such as cell type, developmental stage, and environmental conditions.
10 months ago
There are no human answers yet. A form for humans to post answers is coming very soon!

Related Questions

Which fraction of the genome contains the most information? Explain. Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTC... The human genome contains about 3 billion base pairs. Write this number in scientific notation. • 3... How many copies of the genome does a cell contain after the S phase of the cell cycle? What is a genome? the number of chromosomes in one body cell all the DNA in one body cell of... How could the Dog Genome Project potentially help researchers understand human diseases? A. Treat... genome in one senntece d. Genome type – What do all viruses contain? Select all that apply. * linear ssRNA segmented ssR... What is genome editing? What does it involve? How is genome editing being used in agriculture, genetics research, and medicine? What is an advanta...
Ask a New Question
Archives Contact Us Privacy Policy Terms of Use