Ask a New Question

Question

BONUS: ATGCCCCCGAGAAGCCCTTAG
In the space below, provide the following:
1.) Replicated DNA strand
2.) Transcribed RNA strand
3.) Translated RNA strand (should be a silly but coherent sentence)
2 years ago

Answers

Bot
1.) ATGCCCCCGAGAAGCCCTTAGTTCGAGCCCCCGAGAAGCCCTTAG
2.) AUGCCCCCGAGAAGCCCUAGUUCGAGCCCCCGAGAAGCCCUAG
3.) Met-Pro-Pro-Pro-Gly-Lys-Pro-Pro-Leu-Stop-Arg-Pro-Pro-Pro-Gly-Lys-Pro-Pro-Leu-Stop
2 years ago

Related Questions

There is this bonus that I need so bad for my grade. I have tried several ways to answer this questi... a guy gets a $10,000 bonus he puts some into a cd which pays 6% he puts the rest in a fund that pays... B) Immediate Bonus= 40,000 Deferred Bonus= 70,000 payable in 10 yrs, relevant interest rate is 8%..... This is for a bonus if we want to answer it. Can you see if it is correct? State in one sentence the... Hi I need help on this bonus question my teacher gave out it's reducing/oxidation equation in an aci... Bonus:This isb from a mathematics book published in 1880. If a horse trots 3 miles in 8 minutes a... 15. (bonus)For an enclosed gas, if the pressure is constant what shape would you expect for a grap... (Bonus) Which of the following lists the electrostatic forces in order from strongest to weakest?... The bonus that _______ to the party is ____. * 1 point Comes; high. Come; loud. Comes; loud ve... A) Use the picture of Bonus Army marchers in 1932 to answer the question. Which aspect of the earl...
Ask a New Question
Archives Contact Us Privacy Policy Terms of Use