I. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
answer:
serine-cysteine-tyrosine-arginine-lysine-leucine-arginine-valine-asparagine-isoleucine-leucine-arginine-arginine-serine-aparagine
I. If u is removed:
agu ugu auc gaa aac ugc gag uaa aua ucc uga ggg cgc gaa gca acc
serine-cysteine-isoleucine-glutamic acid-asparagine-cysteine-glutamic acid-stop codon
II. agu ugu auc gaa aac ugc gag uaa aua ucc uga ggg cgc gaa gca acc
answer:
serine-cysteine-serine-glutamic acid-serine-cysteine-glutamic acid-leucine-isoleucine-serine-stop codon
**once stop codon is reached, the translation process of protein will be terminated. STOP CODONS ARE UAG, UGA, UAA
Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
1 answer