Archives
2021
November

Questions Asked on November 29, 2021

Which is one criterion a writer should use when evaluating a source?(1 point)how realistic it is how realistic it is its
1. 11 answers
2. asked by Jay❤
3. 2,753 views
OK so the test is "Impact of Humans Unit Test" for 6th grade(Unit 5 lesson 11)with 12 questions. a few questions have pictures
1. 8 answers
2. asked by A depressed insomniac
3. 2,097 views
You are studying the boiling points of liquids with some fellow students. You have two liquids of different molecular weights,
1. 10 answers
2. asked by Arizonaaaa
3. 2,051 views
Are earthquakes are more destructive than tsunamis?
1. 2 answers
2. asked by Me
3. 1,626 views
Find the volume of the cylinder shown. Use 3.14 for pi. Round your answer to the nearest tenth.A- 1607.7 in^3 Find the volume of
1. 6 answers
2. asked by Nanami Kento
3. 1,330 views
Recall what you have learned about analyzing informational texts to write an analysis of Perfectly Imperfect by Donna Bozzone.
1. 7 answers
2. asked by PLS HELP ME
3. 1,254 views
Graph the solution of the inequality.x ≤ 3 A. A solution is shown graphed on a number line. A number line has tick marks
1. 8 answers
2. asked by dude :-)
3. 1,225 views
Use the paragraph to answer the question. (1) Our town's plastic bag ban is a wise policy. (2) Studies have demonstrated the
1. 3 answers
2. asked by I need Help pls
3. 1,180 views
When you review a text to evaluate its argument, which of the following must you do first?(1 point)identify the author’s claim
1. 7 answers
2. asked by ???
3. 991 views
In three to five sentences, describe how a person can reduce consumption of natural resources when drinking water. Assume that
1. 9 answers
2. asked by lol
3. 985 views
Why has the influx of immigration to Europe created challenges?A. Immigrants are not interested in a better life. Immigrants
1. 7 answers
2. asked by Hi
3. 982 views
The table shows the relationship between the number of sports teams a person belongs to and the amount of free time the person
1. 1 answer
2. asked by Evee
3. 981 views
which format is best to show the sequence of battles fought in the American Revolutionary war? Select the correct answerA. a
1. 8 answers
2. asked by Demetrius
3. 946 views
Why is Iran considered a theocracy
1. 10 answers
2. asked by unknown
3. 938 views
Which change happens when a substance melts?o Hear energy overcomes the forces of attraction between the molecules of the
1. 1 answer
2. asked by Princess
3. 873 views
What makes a source affective? Select the two correct answersA) it adds to your understanding of a topic B) it leads you to
1. 3 answers
2. asked by Pls help :)
3. 843 views
A ramp has a height of 5.8 feet and an angle of 80°. (is a right triangle. above the 90 degree angle is the 80 degree angle)Wha
1. 1 answer
2. asked by ahh~
3. 835 views
What factors influence the amount of inertia an object has?
1. 0 answers
2. asked by Blitzo
3. 816 views
There are 5 more girls than boys in a class.If 2 boys join the class, the ratio of girls to boys will be 5:4. Find (a) the
1. 1 answer
2. asked by Charles
3. 771 views
what was one strength of the Articles of Confederation
1. 1 answer
2. asked by markeese
3. 752 views
In a chemical reaction, the forward rate is greater than the reverse rate. Which statement about the reaction is correct?The
1. 1 answer
2. asked by Evee
3. 742 views
"For Thanksgiving dessert, Mrs. Zappone and her seven family members baked an incredible homemade apple pie. Eight equal slices
1. 1 answer
2. asked by M'Yaan Didier
3. 663 views
Which experiment design would be the best to use in investigating the booking points of water and ethanol?A. Heat samples of
1. 1 answer
2. asked by Puppet
3. 653 views
A car travelling at 81 km/h slams on the brakes and comes to a stop after 2.9 s. What is the force from the seatbelt acting on
1. 0 answers
2. asked by Anonymous
3. 624 views
$60 is shared between Ali,Ben and Carol in the ratio of 5:3:2. How much does Ben get?
1. 2 answers
2. asked by Fatima
3. 607 views
What is the definition of claim
1. 1 answer
2. asked by Anonymous
3. 601 views
Which expression is equivalent to 2(m − 5) + 6?please help with the test
1. 1 answer
2. asked by connexus
3. 588 views
Please please help me on this. I’m confused by it.The poetry you read throughout this unit presents different views of love.
1. 3 answers
2. asked by Crissy
3. 562 views
length of the longest chord of a circle is 18.4 cm, find its radius.
1. 1 answer
2. asked by raju
3. 560 views
what was one reason for the establishment of the Articles of Confederation
1. 1 answer
2. asked by markeese
3. 513 views
Who is one VP who took a very active role in government? What did he do?
1. 2 answers
2. asked by Unknown Person
3. 503 views
Tracy has forgotten how to complete the square. Using the following problem show her how to complete the square: x^2 + 4x - 2 =
1. 1 answer
2. asked by Almondjoy
3. 502 views
3.Problem: "For Thanksgiving dessert, Mrs. Zappone and her seven family members baked an incredible homemade apple pie. Eight
1. 2 answers
2. asked by Chelsia
3. 497 views
Add 15to a number then multiply the result by 3 the answer is the same as subtracting 4 from the number and multiplying the
1. 2 answers
2. asked by Rosabel
3. 487 views
Express the rate $2 for 8 mini boxes of cereal as a unit rate.$__ per mini box of cereal
1. 4 answers
2. asked by Jade
3. 482 views
The center of mass of the arm shown in the figure is at point A. Find the magnitudes (in N) of the tension forceFt and the force
1. 0 answers
2. asked by Maggie
3. 478 views
The ordered pairs (1,1) , (2,8) , (3,27), (4,64) and (5, 125) represent a function. What is a rule that represents this
1. 1 answer
2. asked by Evee
3. 468 views
The demand function for a certain kind of mattress is given byp = 600e^−0.04x where p is the unit price in dollars and x (in
1. 1 answer
2. asked by Darryl
3. 468 views
Find the floor area of a room 5m long and 3m wide
1. 3 answers
2. asked by aishat
3. 466 views
The scale of a map is 2cm to 1km. what is the distance between town "a" and town "b" in km when the distance is 20cm
1. 2 answers
2. asked by James
3. 462 views
A motorist travels from a town P on a bearing of 150° to a town Q 40km away. From Q he travels to a town R on a bearing of
1. 2 answers
2. asked by Anonymous
3. 458 views
The demand function for a certain brand of DVD is given byp = −0.01x^2 − 0.2x + 8 where p is the unit price in dollars and x
1. 2 answers
2. asked by Darryl
3. 433 views
I know, I keep posting questions like this but the tutors aren't even helping. So people that keep getting tired of me posting
1. 1 answer
2. asked by Evee
3. 429 views
James spent 1/5 of his money on a pair of shoes and 1/10 on a book. He saved 2/7 of the remaining money and the rest of the
1. 1 answer
2. asked by lol
3. 412 views
Design a transmission line that can transmit 300 MW of electricity across 200 km with only a 29% loss.Assume the wires are to be
1. 0 answers
2. asked by Spencer
3. 406 views
Shelly has a roll of fabric and decides to make some scarves for her friends.The roll contains 6 2 3 yards of fabric. She needs
1. 1 answer
2. asked by Alfred
3. 399 views
You and your friend are selling magazine subscriptions for a fundraiser. After w weeks, you have sold (3w+4) subscriptions and
1. 1 answer
2. asked by ash
3. 392 views
A syringe has an area of 4 cm2 in the barrel of the syringe and then narrows down to an area of 0.1 mm2 at the needle end. If a
1. 1 answer
2. asked by Bailey
3. 387 views
A fire extinguisher contains a high-pressure liquid so that it can spray the liquid out very quickly when needed. If the fluid
1. 1 answer
2. asked by Bailey
3. 378 views
A cyclist and his bicycle have a combined mass of 55 kg. The total area of the tyres in contact with the road is 2.2 × 10^-3
1. 2 answers
2. asked by helpp
3. 375 views
What ARE the FALLACIES OF FEMALE PARTICIPATION IN SPORTS
1. 2 answers
2. asked by Anonymous
3. 374 views
The two blocks (block 1 with volume V1 = 4 m3 and block 2 with volume V2 = 2 m3) shown in the figure are submerged completely in
1. 0 answers
2. asked by Bailey
3. 364 views
The sum of infinity and the second term of a geometric progression are 4 and 1 respectively. Find the, 1 common ratio, 2 the
1. 1 answer
2. asked by Olabisiy
3. 346 views
minnie is painting her walk in closet. Each gallon covers 275 square feet. The floor is 9ft wide and 7ft long. The roof is 8ft
1. 1 answer
2. asked by shelby
3. 343 views
if 45.0 liters of oxygen is measured at 24.0 C what would be its volume at standard temperature?V= V2= T= T2= I need help pls
1. 0 answers
2. asked by 👩🏻‍🔬🧑🏼‍🔬👨🏽‍🔬
3. 341 views
A courier service company has found that their delivery time of parcels to clients is normally distributed with a mean of 22
1. 1 answer
2. asked by Nelly
3. 338 views
What was the unspoken scandal in your town when growing up?
1. 0 answers
2. asked by Unknown Person 101
3. 329 views
(c) Given the DNA shown below …3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’
1. 0 answers
2. asked by sam
3. 324 views
1. The ordered pairs (1,1), (2,8), (4,64), and (5,125) represents a function. What is a rule that represents this function?A. y
1. 1 answer
2. asked by Evee
3. 323 views
A sample of oxygen occupies 15.0 mL under a pressure of 0.928 atm at 25.0 C. What would be its volume at another time when the
1. 0 answers
2. asked by 👩🏻‍🔬🧑🏼‍🔬👨🏽‍🔬
3. 320 views
I need help with Science Matter Interactions Sample WorkIm falling behind some answers would be nice
1. 0 answers
2. asked by u dont need to know my name
3. 319 views
you are comparing apples to oranges in a fruit bowl. Is the ration 2:3 same as the ratio 3:2 explain.
1. 2 answers
2. asked by julia
3. 314 views
how does salt affect the mass of water without changing the volume
1. 0 answers
2. asked by joseph
3. 306 views
use benchmarks to estimate the sum of 4/9+4/10
1. 1 answer
2. asked by bro
3. 301 views
In the following diagram the bottom block is being pulled downward with a force of 15 N. Calculate the tension in rope A if the
1. 0 answers
2. asked by Anonymous
3. 299 views
In three to five sentences, describe how African Americans won and then lost their rights after the Civil War.
1. 1 answer
2. asked by Anonymous
3. 295 views
The ratio of vowels to consonants in a word is 5 to 7. Are there more vowels or consonants in the word? Explain
1. 1 answer
2. asked by julia
3. 289 views
A car and a train are traveling with the same velocity. Do the two objects have the same momentum?
1. 1 answer
2. asked by anonymous
3. 287 views
Find the equation of a parabola that passes through the points(1,6) (2,20) and (3,40)
1. 2 answers
2. asked by HELP ME PLS
3. 283 views
A glass capillary tube with a radius of 0.2 mm is inserted into an open container filled with an unknown liquid, and the
1. 0 answers
2. asked by Bailey
3. 277 views
GUYS DONT PUT THE LETTERS THEY ARE ALL MIXED UP FOR DIFFRENT THINGS PUT THE ANSWERS NOT LETTERS
1. 1 answer
2. asked by connexus
3. 277 views
Suppose T varies directly as the 3/2 power of x. When x = 16, T= 80. Find T when x = 4
1. 1 answer
2. asked by Anonymous
3. 275 views
b) BclI cleaves after the first T:3’ TGATCA 5’ 5’ ACTAGT 3’ Does cleavage by BclI result in a 5’ or 3’ overhang?
1. 0 answers
2. asked by sam
3. 274 views
34 mL of nitrogen gas is measured at 21.0 C and 0.953 atm pressure. Calculate the volume at STP
1. 1 answer
2. asked by 👩🏻‍🔬🧑🏼‍🔬👨🏽‍🔬
3. 273 views
A square tile has a side length of 12 inches. Write the power as an expression with a base and an exponent. Then find the area
1. 1 answer
2. asked by Anonymous
3. 268 views
How do I write this in slope intercept form5x+6y=9 What do I do
1. 2 answers
2. asked by 🍔🍔🍔🍔🍔🍔🍔
3. 267 views
Name the era And period in which following events occur or happens? A. Development of evolution of bacteria
1. 1 answer
2. asked by Anonymous
3. 266 views
Paj is filling a 9-cubic-inch flower pot with soil from small bags. Each bag of soil contains2 2/3cubic inches of soil. Exactly
1. 1 answer
2. asked by Anonymous
3. 261 views
Determine whether y varies directly with x. If so, find the constant of variation k and write the equation.\table[[x,y],[18,6],[
1. 1 answer
2. asked by JOE
3. 261 views
A pulley is turning at 30 revolutions per second slows down uniformly to 20 revolutions per second in 2 seconds .Calculate the
1. 0 answers
2. asked by Nrl
3. 256 views
what
1. 2 answers
2. asked by MauriceJ49
3. 255 views
Find the equation in point slope form of the line that passes through the point (1,2) with slope m=2/3
1. 1 answer
2. asked by 🍔🍔🍔🍔🍔🍔🍔
3. 254 views
explain why the recessive trait disappears in the f1 generation (when parent 1 is homozygous dominant and parent 2 s homozygous
1. 0 answers
2. asked by LGQNED
3. 254 views
Find the slope of the line that passes through the pair of points.(-44.82,5.5) and (4.82,4) The slope is ___ (It's a fraction
1. 2 answers
2. asked by Evee
3. 244 views
Find the point that maximizes the objective functions p=2x+5y using the constraints:{x ≥ 0, y ≥ 0 {y ≥ 10 - 2x {y ≤ 7 -
1. 1 answer
2. asked by HELP ME PLS
3. 244 views
Using the method of substitution solve the following system of equations y =3x-2 y=-2x-7
1. 1 answer
2. asked by Abdulrahman
3. 242 views
the first and third terms of a G.P are 5 and 80 respectively.what is the 4th term
1. 1 answer
2. asked by Anonymous
3. 237 views
Calculate the number of 2 3/8 inch pieces of wire that can be cut from a 95 inch coil (there is no wastage in cutting)
1. 1 answer
2. asked by Keithshan Neely
3. 233 views
Jennifer is a 29-year-old administrative assistant married to Antonio, an Italian engineer, whom Jennifer met four years earlier
1. 1 answer
2. asked by Aaira
3. 232 views
a) BamHI, cleaves after the first G:3’ GGATCC 5’ 5’ CCTAGG 3’ Does cleavage by BamHI result in a 5’ or 3’ overhang?
1. 0 answers
2. asked by sam
3. 228 views
Why does water Slowly evaporate at 25 degrees Celcius?
1. 1 answer
2. asked by Student
3. 226 views
What is the rule if the input is 5 and output is 2 than input is 6and output is 3than input is 7and output 5 than input is 8 and
1. 1 answer
2. asked by Anonymous
3. 225 views
Bre ran 2 1/2 miles in 2/5 of an hour.How long would it take Bre to run 1 mile at that rate? It would take Bre________ of an
1. 1 answer
2. asked by Person
3. 225 views
Cost of item 101 selling price 111.91 tax amount tax rate
1. 1 answer
2. asked by Anonymous
3. 213 views
A gas collected at a temperature of 0 C has a volume of 380 mL. At what temperature will the gas have a volume of 500 mL?
1. 0 answers
2. asked by 👩🏻‍🔬🧑🏼‍🔬👨🏽‍🔬
3. 206 views
A boy spent 19\35 of his pocket money on food what fraction of his money is left?
1. 1 answer
2. asked by Amos
3. 201 views
Alex is getting a Wi-Fi hotspot that costs $40 and has a monthly data plan of $25/month. How much would he spend over the course
1. 2 answers
2. asked by 🍔🍔🍔🍔🍔🍔
3. 198 views
i like all of you family together with as new yourk we are here now with you okay bye
1. 2 answers
2. asked by miracle
3. 196 views
If you had to change the language you speak, which one would you choose?
1. 0 answers
2. asked by Unknown Person 101
3. 195 views
A baseball diamond is a square woth 90 foot sides of the catchers is standing on home plate what is the approximate distance to
1. 1 answer
2. asked by Jasa
3. 194 views

Back to November 2021

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025