Archives
2016
October

Questions Asked on October 28, 2016

rearrange A = 2 pi r (r+h) to make h the subject(cylinder)
1. 2 answers
2. asked by melanie
3. 8,686 views
You must scuba dive to the entranceof your room at Jules’ Undersea Lodge in Key Largo, Florida. The diver is 1 foot deeper
1. 22 answers
2. asked by vivis
3. 8,094 views
What was the unanswered question of the Nullification CrisisA). does the federal government have absolute power to place traffic
1. 10 answers
2. asked by Izzie
3. 7,587 views
The narrator of stolen day says his family often laughs at him.How does he react when they do?A.He wishes he were an orphan.
1. 61 answers
2. asked by I NEED HELP PLEASE!!!
3. 7,510 views
14. which quotation from nethergrave best conveys jeremys desire to escape the real world.a. "oh, i guess you mean those stories
1. 4 answers
2. asked by New qustions
3. 6,652 views
Given these reactions :X(s) + 1/2O2(g) --> XO(s) (Delta)H= -707.7 kj XCO3(s) --> XO(s)+CO2(g) (Delta)H= +381.9kj What is
1. 1 answer
2. asked by anon
3. 6,513 views
what is a common tradition for families in the Spanish speaking world that is not necessarily a tradition in America?A)men and
1. 11 answers
2. asked by Cyborg_DRAGon
3. 4,677 views
None of the students ________ happy with the instructor because she ________ homework every weekend.
1. 5 answers
2. asked by Anonymous
3. 4,496 views
BMI is a ratio to?•Height to body fat •Weight to height •Muscle mass to bone mass •weight to activity level
1. 18 answers
2. asked by Shayla
3. 4,445 views
Hi. I need to check my answers and I would hate to get them wrong because of one little mistake. Thanks!1. An argumentative
1. 9 answers
2. asked by Dani
3. 4,365 views
Has anyone done the effect of cell size on material transport portfolio in Connections academy?
1. 6 answers
2. asked by Amanda
3. 4,180 views
It takes 18 electricians 35 days to wire a new housing subdivision. How many days would 28 electricians require to do the same
1. 11 answers
2. asked by allie
3. 3,819 views
Increased suffrage and the development of new political parties in the early 1800s indicate which of the following#1 expansion
1. 2 answers
2. asked by Need_help_fast
3. 3,723 views
How much sulphuric acid containing 90% H2SO4 by wt. is needed for the production of 1000 kg of HCl containing 42% HCl by weight
1. 5 answers
2. asked by Kritim
3. 3,644 views
Working together, two people can cut out a large lawn in 2 hr. One person can do the job alone in 1 hr less than the other? How
1. 1 answer
2. asked by Darleene Gomez
3. 3,450 views
A ball of mass 0.15kg is dropped from a height of 1.0m onto a flat surface and rebounds to a height of 0.35m.Calculate: (a) The
1. 2 answers
2. asked by urgent help needed
3. 3,169 views
What value of c makes x^2 + 6x + c a perfect square trinomial?3 6 9 12
1. 1 answer
2. asked by Don
3. 3,138 views
A car is backing up at a rate of 10km/hr. If the driver looks through his rear-view mirror, how fast does a tree, which is
1. 2 answers
2. asked by Katherine
3. 2,851 views
two blocks (a and b) are in contact on a horizontal frictionless surface. a 60N constant horizontal force is applied to A. the
1. 1 answer
2. asked by Jane
3. 2,738 views
If the rotational speed of a CD changes from 550 rpm to 200 rpm as it plays 30 minutes of music, what is the CD's average
1. 1 answer
2. asked by Katelyn
3. 2,666 views
Please write down the redox reactions (using the half-reaction method!)a)Cl2 from OCl- and Cl- in acidic solution b)Br2 from
1. 2 answers
2. asked by Annie
3. 2,603 views
When 1367 J of heat energy is added to 44.1 g of hexane, C6H14, the temperature increases by 13.7 °C. Calculate the molar heat
1. 2 answers
2. asked by sam
3. 2,568 views
How many grams of H2O are required to react with excess CaC2 to produce 23.0 g of C2H2 according to the following equation?CaC2
1. 1 answer
2. asked by Rebecca
3. 2,534 views
I am a number between 80 and 90 if you remove one from me I become a multiple of 5. If you add 2 to me I become a multiple of 8
1. 2 answers
2. asked by rola
3. 2,533 views
Acrostic poem for L A N D F O R M S
1. 3 answers
2. asked by txhnth
3. 2,457 views
What is 51 tens and 9 ones
1. 7 answers
2. asked by Anonymous
3. 2,412 views
Consider these reactions where M represents a generic metal1. 2M(s) +6HCl(aq) --> 2MCl3(aq)+3H2(g) (deltaH)= -725.0 kj 2.
1. 1 answer
2. asked by anon
3. 2,407 views
PLEASE PLEASE HELP ME WITH THESE 2 PROBLEMS STEP BY STEP AND SHOW WORK! z/12=9 what is the value of z show how you found it. 5 x
1. 7 answers
2. asked by Connections Academy 6th grade
3. 2,313 views
- La Peregrina= The PilgrimOk, so I have submitted the questions I have to answer in the form they were presented to me. Below
1. 6 answers
2. asked by Jaylnn
3. 2,289 views
Calculate the value of work, w, for the following system if 26.7 g of NaN3 reacts completely at 1.00 atm and 22 °C.
1. 1 answer
2. asked by Morgan
3. 2,178 views
Which of the following passages from the pigman and me help to create a humorous mood?A. I just shut up and stared down at the
1. 18 answers
2. asked by naenaecutegirl
3. 2,046 views
Jessica had $15. She bought 3 apples for x dollars each. Levi had $27 and bought 5 apples for x dollars each. Which expression
1. 5 answers
2. asked by Forg
3. 2,017 views
What natural resource attracted other nations to trade with West and Central Africa beginning around AD 750?A. copper B. silver
1. 6 answers
2. asked by Anonymous
3. 1,944 views
Grammatically correct?Mi hermana es muy trabajadora? Correct <--- Incorrect Tengo un perro que esta muy tonto, siempre se quiere
1. 2 answers
2. asked by Jenna
3. 1,918 views
Lenora is using the recipe of 1/3 cup vegetable oil, 1/4 cup vinegar, salt and pepper to taste. She wants to make 20 batches of
1. 3 answers
2. asked by Arianna
3. 1,878 views
If two dice are rolled and their faces noted, find each of the following probabilities:a) the sum of the two dice is 8 b) both
1. 1 answer
2. asked by Anonymous
3. 1,842 views
How many international direct-dialing numbers are possible if each number consists of a four-digit area code (the first digit of
1. 1 answer
2. asked by Kal Jay
3. 1,824 views
450 children take part in an art competition if there are 25% more boys than girls how many more boys than girls are there
1. 1 answer
2. asked by Ally
3. 1,797 views
How can readers best analyze and evaluate persuasive appeals?A. by testing the author’s logic and reasoning B. by outlining
1. 7 answers
2. asked by need help now
3. 1,796 views
Given the vectors u = <−3, 7> and v = <5,1>, find 3u + 2v.
1. 1 answer
2. asked by Iris
3. 1,756 views
Tom used 5/8 yard of ribbon to tie weights on the tail of his kite. He cut the length of ribbon in equal pieces that were 1/12
1. 3 answers
2. asked by Thomas
3. 1,749 views
How to derive cosh (3x) in terms of cosh (x) and sinh (x) ? Initially I start with 1/2 (e^3x+e^-3x) but I'm stuck from there
1. 2 answers
2. asked by Matilda
3. 1,722 views
Dan wants to cover a Shelf with shelf liner the Shelf is 4 feet wide and 2/3 feet deep what is the area of the Shelf
1. 4 answers
2. asked by Tamika
3. 1,710 views
An employee's annual salary was increased from $22,464.00 to $24,710.40 last year.If it is increased by the same percent this
1. 1 answer
2. asked by Sandy
3. 1,621 views
Which of the following is a characteristic of Earth's first people?A. They lived in cold places B. They lives far from water
1. 4 answers
2. asked by Anonymous
3. 1,593 views
In First Confessions, Nora can best be identified as?A:flat*** B:round C:dynamic D:protagonist
1. 7 answers
2. asked by Anonymous
3. 1,579 views
A child with a mass of 17 kg sits at a distance of 1 m from the pivot point of a seesaw. Where should a 15 kg child sit to
1. 1 answer
2. asked by Jessica
3. 1,502 views
1. Which of the following crimes would result in a slave’s execution? (Choose all that apply.) (2 points)murder failing to
1. 7 answers
2. asked by You yo daddy's son
3. 1,411 views
A child with a mass of 46 kg is riding on a merry-go-round. If the child has a speed of 3 m/s and is located 2.2 m from the
1. 2 answers
2. asked by Sue
3. 1,160 views
In a constant-pressure calorimeter, 60.0 mL of 0.300 M Ba(OH)2 was added to 60.0 mL of 0.600 M HCl. The reaction caused the
1. 1 answer
2. asked by sam
3. 1,149 views
Have trouble with math mixtures problem!!AT a family reunion, the average age of all those present was 45 years. If the two
1. 2 answers
2. asked by Jess
3. 1,123 views
Which of the following is a serious economic problem in North Africa?A. lack of oil resources B. a decline in tourism C.
1. 6 answers
2. asked by Anonymous
3. 1,090 views
A state university annual report showed that its retention rate was at 24% and university officials would like to increase this
1. 1 answer
2. asked by Tameka
3. 1,086 views
What is the thesis statement in this essay?Instead of using emails, mail a letter to your grandparents, an aunt or uncle, or
1. 14 answers
2. asked by anonymous
3. 1,065 views
An octopus can swim v km/h in still water. When the octopus swims against a current of 5km/h, its speed is decreased by 5km/h.
1. 2 answers
2. asked by jesse
3. 1,048 views
Lorraine is placing tiles in rows.In each succeeding row,she doubles the number of tiles.The ninth row has 768 tiles.How many
1. 1 answer
2. asked by Chase
3. 1,028 views
Three children are riding on the edge of a merry–go–round that is 84 kg, has a 1.40–m radius, and is spinning at 20.0 rpm.
1. 7 answers
2. asked by Ashley
3. 1,022 views
Tell whether the sequence is arithmetic. if it is what is the common difference?A. no B. 1/4 C. 1/8 D. 8 My best answer is A. is
1. 5 answers
2. asked by Leslie
3. 1,020 views
The following equation is the balanced combustion reaction for C6H6:2C6H6(L) + 15O2(g) --> 12CO2(g)+6H2O(L)+6543 kj If 7.700 g
1. 1 answer
2. asked by anon
3. 1,013 views
You invest $75.00 the first month and $100.00 the second month at 3.75% APR. How much interest do you get at the end of the
1. 2 answers
2. asked by Anonymous
3. 999 views
Six slips of paper, with a different digit from 1 to 6 printed on each, are placed in a box. The papers are well mixed. One slip
1. 2 answers
2. asked by Anonymous
3. 994 views
Which point is located at (-3, -2)
1. 4 answers
2. asked by Maytag
3. 987 views
What is a name for a baby bird that ends in ip?
1. 1 answer
2. asked by Hayleigh
3. 981 views
What natural resource attracted other nations to trade with West and Central Africa beginning around AD 750?A. copper B. silver
1. 1 answer
2. asked by Anonymous
3. 956 views
Three children are riding on the edge of a merry–go–round that is 84 kg, has a 1.40–m radius, and is spinning at 20.0 rpm.
1. 1 answer
2. asked by Cristina
3. 951 views
Robin is standing terrified at the end of a diving board, which is high above the water. If Robin has a mass of 56 kg and is
1. 1 answer
2. asked by Heather
3. 942 views
Calculate the heat that must be supplied to 10.5 g of Ne(g) at 0.15 atm to raise its temperature from 24◦C to 54◦C at
1. 3 answers
2. asked by David
3. 940 views
Your brother is saving labels from soup cans. He removes the labels from three cans of pea soup,five cans of vegetable soup and
1. 1 answer
2. asked by Anonymous
3. 935 views
Calculate the standard enthalpy change for the following reaction at 25 °C.H2O+C(graphite)(s) --> H2(g) +CO(g)
1. 1 answer
2. asked by anon
3. 914 views
A solution of NaOH(aq) contains 5.4 g of NaOH(s) per 100.0 mL of solution. Calculate the pH and the pOH of the solution at 25
1. 1 answer
2. asked by Anonymous
3. 906 views
If 3.60 moles of SiO2 and 3.60 moles of C react to form SiC accodring to the equationSiO2 + 3 C -> SiC + 2 CO how many moles of
1. 1 answer
2. asked by Rebecca
3. 905 views
1. Compare the slope of the distance vs. time graph to the average of all your velocity values. Are they close? Why or why not?
1. 0 answers
2. asked by Kevana
3. 892 views
Suppose 2% of the items made in a factory are defected. Find the probability that no defective in a sample of 50.
1. 0 answers
2. asked by shubham
3. 891 views
A child with a mass of 46 kg is riding on a merry-go-round. If the child has a speed of 3 m/s and is located 2.2 m from the
1. 1 answer
2. asked by Sue
3. 878 views
Calculate the pH of a solution containing 2g of caustic soda per litre of water
1. 1 answer
2. asked by Deepali
3. 877 views
Here are parts of the DNA base sequences for 7 organisms:Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
1. 1 answer
2. asked by Maria
3. 875 views
At constant volume, the heat of combustion of a particular compound is –3947.0 kJ/mol. When 1.311 g of this compound (molar
1. 1 answer
2. asked by anon
3. 805 views
Crackers come in packages of 7. Ethan ate 82 crackers. How many whole boxes did he eat and how many crackers does he have left?
1. 1 answer
2. asked by fardosa
3. 803 views
bus bars are used in an electric iron as
1. 2 answers
2. asked by chris
3. 798 views
Literary Analysis: Character and CharacterizationRead the selection. Then, answer the questions that follow. People who don’t
1. 2 answers
2. asked by Martin1162
3. 797 views
A manufacturer of calculators would like to separate defective calculators from calculators that are acceptable. Through an
1. 1 answer
2. asked by Jenna
3. 787 views
What is the rotational speed of the hour hand on a clock?
1. 1 answer
2. asked by Marian
3. 777 views
terry earns $6.50 per hour babysitting.a. write a rule to describe how the amount of money m earned is a function of the number
1. 2 answers
2. asked by Leslie
3. 777 views
A 2.50-g sample of powdered zinc is added to 100.0 mL of a 2.00-M aqueous solution of hydrobromic acid in a calorimeter. The
1. 0 answers
2. asked by anon
3. 773 views
using cu+2AgNo3= Cu(No3)2 + 2Ag if you start with 100 grams of copper how many grams of silver can be obtained
1. 0 answers
2. asked by jordan
3. 737 views
Write the ratio in simplest form.50:10 A.25:5 B.10:2 C. 5:1 D.1:5 Is the answer C?
1. 3 answers
2. asked by Noah
3. 721 views
An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and
1. 1 answer
2. asked by sam
3. 712 views
An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and
1. 2 answers
2. asked by sam
3. 711 views
When a 8.00-g sample of KBr is dissolved in water in a calorimeter that has a total heat capacity of 3.344 kJ·K–1, the
1. 0 answers
2. asked by anon
3. 711 views
terry earns $6.50 per hour babysitting.a. write a rule to describe how the amount of money m earned is a function of the number
1. 1 answer
2. asked by Leslie
3. 708 views
What is 23/40 minus 22/30? use benchmark
1. 5 answers
2. asked by Princess Flower
3. 708 views
During a triathlon, Sharon swims 1/4 of the total route and cycles 3/5 of the remaining route. She runs the rest of the route.
1. 1 answer
2. asked by Lillianna
3. 700 views
A variable-speed drill, initially turning at 150 rpm, speeds up to 1300 rpm in a time interval of 1.0 s. What is its average
1. 1 answer
2. asked by Sue
3. 682 views
I really need help like, in 5 minutes please!! its this:23/40 minus 11/30
1. 1 answer
2. asked by Princess Flower
3. 680 views
you invest $75.00 the first month and $100.00 the second month at 3.75% APR. How much interest do you get at the end of the
1. 3 answers
2. asked by Anonymous
3. 677 views
A car of mass 1000 kg moving with a velocity of 30m/s applies break and stop after 3s. Find the magnitude of retarding force,
1. 1 answer
2. asked by Priyanshu
3. 671 views
One bag of m&m's weighs 3 1/2 pounds. If found friends want to share the bag of candy equally, how much would each friend get?
1. 3 answers
2. asked by Monroe
3. 658 views
1. Do you want to know more?(What is the part of speech of 'more'? Is it an adjective or an adverb?) 2. Look at this map of
1. 4 answers
2. asked by rfvv
3. 645 views
You are hired by your local member of parliament to conduct a survey on unemployment, crime,taxes and mail delivery. You make up
1. 1 answer
2. asked by Anonymous
3. 644 views
an area several km from an electricity generating station requires 120kw power on average the total resistance is line is 0.4
1. 0 answers
2. asked by shehzad
3. 639 views

Back to October 2016

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025