Archives
2016
October

Questions Asked on October 28, 2016

Increased suffrage and the development of new political parties in the early 1800s indicate which of the following#1 expansion
1. 2 answers
2. asked by Need_help_fast
3. 3,701 views
what is a common tradition for families in the Spanish speaking world that is not necessarily a tradition in America?A)men and
1. 11 answers
2. asked by Cyborg_DRAGon
3. 4,659 views
If 3.60 moles of SiO2 and 3.60 moles of C react to form SiC accodring to the equationSiO2 + 3 C -> SiC + 2 CO how many moles of
1. 1 answer
2. asked by Rebecca
3. 885 views
Acrostic poem for L A N D F O R M S
1. 3 answers
2. asked by txhnth
3. 2,438 views
How many grams of H2O are required to react with excess CaC2 to produce 23.0 g of C2H2 according to the following equation?CaC2
1. 1 answer
2. asked by Rebecca
3. 2,522 views
Literary Analysis: Character and CharacterizationRead the selection. Then, answer the questions that follow. People who don’t
1. 2 answers
2. asked by Martin1162
3. 782 views
Emily bought a pie. Emily ate 2/3 of the pie and Ryan ate 1/5 of the pie. How much of the original pie is left?
1. 1 answer
2. asked by Juan
3. 593 views
What is a name for a baby bird that ends in ip?
1. 1 answer
2. asked by Hayleigh
3. 975 views
Robin is standing terrified at the end of a diving board, which is high above the water. If Robin has a mass of 56 kg and is
1. 1 answer
2. asked by Heather
3. 928 views
How can readers best analyze and evaluate persuasive appeals?A. by testing the author’s logic and reasoning B. by outlining
1. 7 answers
2. asked by need help now
3. 1,779 views
A child with a mass of 17 kg sits at a distance of 1 m from the pivot point of a seesaw. Where should a 15 kg child sit to
1. 1 answer
2. asked by Jessica
3. 1,491 views
What is the rotational speed of the hour hand on a clock?
1. 1 answer
2. asked by Marian
3. 764 views
Lenora is using the recipe of 1/3 cup vegetable oil, 1/4 cup vinegar, salt and pepper to taste. She wants to make 20 batches of
1. 3 answers
2. asked by Arianna
3. 1,866 views
You invest $75.00 the first month and $100.00 the second month at 3.75% APR. How much interest do you get at the end of the
1. 2 answers
2. asked by Anonymous
3. 992 views
Suppose the average weight for population of men is 178 pounds. You draw a random sample of 10 men and record the following
1. 0 answers
2. asked by Bob
3. 569 views
Grammatically correct?Mi hermana es muy trabajadora? Correct <--- Incorrect Tengo un perro que esta muy tonto, siempre se quiere
1. 2 answers
2. asked by Jenna
3. 1,909 views
During a triathlon, Sharon swims 1/4 of the total route and cycles 3/5 of the remaining route. She runs the rest of the route.
1. 1 answer
2. asked by Lillianna
3. 685 views
Jessica had $15. She bought 3 apples for x dollars each. Levi had $27 and bought 5 apples for x dollars each. Which expression
1. 5 answers
2. asked by Forg
3. 2,007 views
A ball bounces off the edge of a table at an initial velocity of 1.5 m/s at an angle of 30 degrees above the table, falling to
1. 1 answer
2. asked by Camden
3. 411 views
A car is backing up at a rate of 10km/hr. If the driver looks through his rear-view mirror, how fast does a tree, which is
1. 2 answers
2. asked by Katherine
3. 2,829 views
A frog jumps at 0.6 m/s at an angle of 20 degrees and lands on a level surface. How far does the frog jump?
1. 1 answer
2. asked by Camden
3. 618 views
If you combine 360.0 mL of water at 25.00 °C and 120.0 mL of water at 95.00 °C, what is the final temperature of the mixture?
1. 1 answer
2. asked by sam
3. 491 views
An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and
1. 1 answer
2. asked by sam
3. 704 views
If the rotational speed of a CD changes from 550 rpm to 200 rpm as it plays 30 minutes of music, what is the CD's average
1. 1 answer
2. asked by Katelyn
3. 2,653 views
Consider a mole of gas obeying the equation of state P⋅V = n⋅R⋅T + n⋅B(T)⋅P. Find w, q, ΔU, ΔS, ΔH, ΔA, and ΔG
1. 0 answers
2. asked by Joesph
3. 479 views
need help in below question. Thanks.A man runs round a circular track at a constant speed. Would like to know how to drawn locus
1. 1 answer
2. asked by peterlaw
3. 477 views
Implicit Differentiation for (x^2+y^2)^6
1. 1 answer
2. asked by Steve
3. 355 views
Lorraine is placing tiles in rows.In each succeeding row,she doubles the number of tiles.The ninth row has 768 tiles.How many
1. 1 answer
2. asked by Chase
3. 1,014 views
two blocks (a and b) are in contact on a horizontal frictionless surface. a 60N constant horizontal force is applied to A. the
1. 1 answer
2. asked by Jane
3. 2,726 views
One bag of m&m's weighs 3 1/2 pounds. If found friends want to share the bag of candy equally, how much would each friend get?
1. 3 answers
2. asked by Monroe
3. 641 views
In a constant-pressure calorimeter, 60.0 mL of 0.300 M Ba(OH)2 was added to 60.0 mL of 0.600 M HCl. The reaction caused the
1. 1 answer
2. asked by sam
3. 1,135 views
would apppeciate very much is anyone can help me in the below question. thanks.A man runs round a circular track at a constant
1. 1 answer
2. asked by peterlaw
3. 487 views
When 1367 J of heat energy is added to 44.1 g of hexane, C6H14, the temperature increases by 13.7 °C. Calculate the molar heat
1. 2 answers
2. asked by sam
3. 2,555 views
Liquid sodium is being considered as an engine coolant. How many grams of liquid sodium (minimum) are needed to absorb 7.00 MJ
1. 1 answer
2. asked by sam
3. 581 views
A ball is thrown with velocity of v feet per second, at an angle of theta with the horizontal.find the vertical and horizontal
1. 1 answer
2. asked by lovi
3. 471 views
What is 51 tens and 9 ones
1. 7 answers
2. asked by Anonymous
3. 2,398 views
Have trouble with math mixtures problem!!AT a family reunion, the average age of all those present was 45 years. If the two
1. 2 answers
2. asked by Jess
3. 1,110 views
A child with a mass of 46 kg is riding on a merry-go-round. If the child has a speed of 3 m/s and is located 2.2 m from the
1. 2 answers
2. asked by Sue
3. 1,146 views
A variable-speed drill, initially turning at 150 rpm, speeds up to 1300 rpm in a time interval of 1.0 s. What is its average
1. 0 answers
2. asked by Sue
3. 547 views
- La Peregrina= The PilgrimOk, so I have submitted the questions I have to answer in the form they were presented to me. Below
1. 6 answers
2. asked by Jaylnn
3. 2,253 views
1. Compare the slope of the distance vs. time graph to the average of all your velocity values. Are they close? Why or why not?
1. 0 answers
2. asked by Kevana
3. 885 views
Bob the builder bought 4.4 pounds of nails for $24.64. How much does one pound of nail cost?
1. 5 answers
2. asked by Monroe
3. 495 views
How much sulphuric acid containing 90% H2SO4 by wt. is needed for the production of 1000 kg of HCl containing 42% HCl by weight
1. 5 answers
2. asked by Kritim
3. 3,627 views
you invest $75.00 the first month and $100.00 the second month at 3.75% APR. How much interest do you get at the end of the
1. 3 answers
2. asked by Anonymous
3. 670 views
The block of mass 2.13615 kg has an acceler- ation of 3.7 m/s2 as shown.What is the magnitude of F? Assume the acceleration due
1. 0 answers
2. asked by Jessica
3. 618 views
PLEASE PLEASE HELP ME WITH THESE 2 PROBLEMS STEP BY STEP AND SHOW WORK! z/12=9 what is the value of z show how you found it. 5 x
1. 7 answers
2. asked by Connections Academy 6th grade
3. 2,300 views
computer-controlled display screens provide drivers in the Indianapolis 500 with a variety of information about how their cars
1. 1 answer
2. asked by bob
3. 512 views
a car at 54 km\h is 60 km behind a truck traveling at 10 m\s. how long will it take the car to reach the truck?
1. 1 answer
2. asked by Zahraa
3. 390 views
Can you check the following problems?Factor the following. 1. x^2 + 9x + 18 = (x + 6)(x + 3) 8. 3x^3 - 24x^2 - 60x = 3x(x^2 - 8x
1. 2 answers
2. asked by Alexis
3. 546 views
1. Do you want to know more?(What is the part of speech of 'more'? Is it an adjective or an adverb?) 2. Look at this map of
1. 4 answers
2. asked by rfvv
3. 637 views
a car at 54 km\h is 60 km behind a truck traveling at 10 m\s. how long will it take the car to reach the truck?
1. 1 answer
2. asked by Zahraa
3. 390 views
Three children are riding on the edge of a merry–go–round that is 84 kg, has a 1.40–m radius, and is spinning at 20.0 rpm.
1. 7 answers
2. asked by Ashley
3. 1,007 views
Billy weighs 50lbs less then his brother together they weigh 210lbs what is the equation to figure out how much billy weighs
1. 1 answer
2. asked by Jon
3. 417 views
Crackers come in packages of 7. Ethan ate 82 crackers. How many whole boxes did he eat and how many crackers does he have left?
1. 1 answer
2. asked by fardosa
3. 787 views
An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and
1. 2 answers
2. asked by sam
3. 699 views
If Aaron split 01 pencil between 7 people in his class and kept the left overs, how many pencils did each classmate get?
1. 3 answers
2. asked by fardosa
3. 315 views
A car of mass 1000 kg moving with a velocity of 30m/s applies break and stop after 3s. Find the magnitude of retarding force,
1. 1 answer
2. asked by Priyanshu
3. 660 views
You must scuba dive to the entranceof your room at Jules’ Undersea Lodge in Key Largo, Florida. The diver is 1 foot deeper
1. 22 answers
2. asked by vivis
3. 8,077 views
Compute derivative using the definition of the derivative.f(x)=1+1/x^2 1+ 1/(x+h)^2 - (1+ 1/(x^2)) ------ divide by h and
1. 2 answers
2. asked by Ray
3. 571 views
An octopus can swim v km/h in still water. When the octopus swims against a current of 5km/h, its speed is decreased by 5km/h.
1. 2 answers
2. asked by jesse
3. 1,037 views
Please write down the redox reactions (using the half-reaction method!)a)Cl2 from OCl- and Cl- in acidic solution b)Br2 from
1. 2 answers
2. asked by Annie
3. 2,589 views
an area several km from an electricity generating station requires 120kw power on average the total resistance is line is 0.4
1. 0 answers
2. asked by shehzad
3. 624 views
3C minus 243
1. 1 answer
2. asked by suzy
3. 377 views
Tom used 5/8 yard of ribbon to tie weights on the tail of his kite. He cut the length of ribbon in equal pieces that were 1/12
1. 3 answers
2. asked by Thomas
3. 1,735 views
A ball roll down a hill with a constant acceleration of 20m/s if the ball start from rest. What is it velocity at the end of
1. 1 answer
2. asked by Elisha
3. 500 views
By making the substitution u=7^x and using part a, derive a hidden quadratic equation7^(2x-1) +4×7^(x-1) -1/14 =0 and hence
1. 2 answers
2. asked by Please help me!
3. 571 views
By making the substitution u =ln x show that the following equation has exactly one real-number solution:9/ln x + ln x^4 =-12
1. 2 answers
2. asked by Please help me!
3. 453 views
A ball of mass 0.15kg is dropped from a height of 1.0m onto a flat surface and rebounds to a height of 0.35m.Calculate: (a) The
1. 2 answers
2. asked by urgent help needed
3. 3,151 views
A uniform ladder of length 20.0m and weight 750 N is propped up against a smooth vertical wall with its lower end on a rough
1. 0 answers
2. asked by urgent help needed
3. 597 views
X squared-36 and 2x square -15x+18
1. 1 answer
2. asked by Nitesh
3. 346 views
P, Q and R start from the same place X at (a) kmph, (a+b) kmph and (a+2b) kmph respectively. If Q starts p hours after P,
1. 0 answers
2. asked by vipul
3. 617 views
With aid of pear if compass and ruler bisect a line of 12cm.
1. 1 answer
2. asked by ZIONKING'S
3. 387 views
What is Conditioning coach and Conditioning activities..?
1. 1 answer
2. asked by Jo
3. 401 views
If one be added to the numerator of a fraction it reduces to 1/5 if one be taken from the denomenator it reduces to 1/7 require
1. 1 answer
2. asked by Anonymous
3. 477 views
How to derive cosh (3x) in terms of cosh (x) and sinh (x) ? Initially I start with 1/2 (e^3x+e^-3x) but I'm stuck from there
1. 2 answers
2. asked by Matilda
3. 1,710 views
Dan wants to cover a Shelf with shelf liner the Shelf is 4 feet wide and 2/3 feet deep what is the area of the Shelf
1. 4 answers
2. asked by Tamika
3. 1,701 views
12%+17%+3%=0.144612The correct answer is 32% Please break it down to me where I can understand it. Thanks
1. 1 answer
2. asked by Sandy
3. 359 views
I am a number between 80 and 90 if you remove one from me I become a multiple of 5. If you add 2 to me I become a multiple of 8
1. 2 answers
2. asked by rola
3. 2,522 views
What was the unanswered question of the Nullification CrisisA). does the federal government have absolute power to place traffic
1. 10 answers
2. asked by Izzie
3. 7,553 views
An athlete jumps straight upwards at 2.5 m/s, find: 1. a) total flight time 2. b) maximum jump height
1. 1 answer
2. asked by Matt
3. 465 views
inversion of S configuration to R configuration?????
1. 1 answer
2. asked by Anonymous
3. 430 views
A variable-speed drill, initially turning at 150 rpm, speeds up to 1300 rpm in a time interval of 1.0 s. What is its average
1. 1 answer
2. asked by Sue
3. 670 views
A child with a mass of 46 kg is riding on a merry-go-round. If the child has a speed of 3 m/s and is located 2.2 m from the
1. 1 answer
2. asked by Sue
3. 865 views
examine the impact of one's family background and setting to work place behaviour?
1. 1 answer
2. asked by George
3. 539 views
Here are parts of the DNA base sequences for 7 organisms:Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
1. 1 answer
2. asked by Maria
3. 864 views
2x^2 - 5y = _______ 3x^2 - 4
1. 1 answer
2. asked by melanie
3. 343 views
rearrange A = 2 pi r (r+h) to make h the subject(cylinder)
1. 2 answers
2. asked by melanie
3. 8,669 views
Tell whether the sequence is arithmetic. if it is what is the common difference?A. no B. 1/4 C. 1/8 D. 8 My best answer is A. is
1. 5 answers
2. asked by Leslie
3. 1,010 views
BMI is a ratio to?•Height to body fat •Weight to height •Muscle mass to bone mass •weight to activity level
1. 18 answers
2. asked by Shayla
3. 4,425 views
terry earns $6.50 per hour babysitting.a. write a rule to describe how the amount of money m earned is a function of the number
1. 2 answers
2. asked by Leslie
3. 763 views
A manufacturer of calculators would like to separate defective calculators from calculators that are acceptable. Through an
1. 1 answer
2. asked by Jenna
3. 768 views
A solution of concentrated NaOH is 16.7M. If the density of the solution is 1.02 g/mL, what is the percent by mass of NaOH?I
1. 1 answer
2. asked by Anonymous
3. 541 views
Suppose 2% of the items made in a factory are defected. Find the probability that no defective in a sample of 50.
1. 0 answers
2. asked by shubham
3. 877 views
What value of c makes x^2 + 6x + c a perfect square trinomial?3 6 9 12
1. 1 answer
2. asked by Don
3. 3,128 views
A solution of concentrated NaOH is 16.7M. If the density of the solution is 1.02 g/mL, what is the percent by mass of NaOH?I
1. 1 answer
2. asked by Anonymous
3. 488 views
A landscape designer recommends that a fence be put around a circular flower bed that is 220 ft.How many feet of fence is needed
1. 4 answers
2. asked by candy
3. 551 views
If you combine 360.0 mL of water at 25.00 °C and 120.0 mL of water at 95.00 °C, what is the final temperature of the mixture?
1. 1 answer
2. asked by anon
3. 546 views
An 80.0-gram sample of a gas was heated from 25 °C to 225 °C. During this process, 346 J of work was done by the system and
1. 1 answer
2. asked by anon
3. 531 views
When 1367 J of heat energy is added to 44.1 g of hexane, C6H14, the temperature increases by 13.7 °C. Calculate the molar heat
1. 1 answer
2. asked by anon
3. 507 views
Liquid sodium is being considered as an engine coolant. How many grams of liquid sodium (minimum) are needed to absorb 7.00 MJ
1. 1 answer
2. asked by anon
3. 621 views

Back to October 2016

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2024