Archives
2014
November

Questions Asked on November 30, 2014

A circle having an area of 452 square inches is cut into two segments by a chord, which is 6 inches from the center of the
1. 2 answers
2. asked by Sol
3. 11,597 views
A car starting at 12:00 noon travels west at a speed of 30 kph. Another car starting from the same point at 2:00 PM travels
1. 1 answer
2. asked by @jayr
3. 1,893 views
Postwar America (1918-1920) faced social change. Explain in 3-5 sentences the changes that occurred at this time.
1. 2 answers
2. asked by Daniel
3. 546 views
I need step by step how to get the answer, I have been trying for hours, 4+m divided by 3 = 5/6 i have the answer just don't
1. 2 answers
2. asked by Bobby
3. 429 views
What is the riddle for moving words
1. 4 answers
2. asked by Chris
3. 1,009 views
For the function: f(x)= 2+x-x^2/ (x-1)^2 ; f'(x)= x-5/(x-1)^3 ; f''(x)=2x-14/(x-1)^4a)find vertical and horizontal asymptotes.
1. 1 answer
2. asked by Sarah
3. 539 views
convert these symmetric equations to parametric form:line 1:(x-1)/k = (y-2)/2 = (z+1)/k-1 and line 2: (x+3)/-2 = (z)/1, y=-1
1. 0 answers
2. asked by Sarah
3. 395 views
In radiation therapy,a.isotopes are traced through a chemical reaction. b.unhealthy human cells are destroyed. c.radioactive
1. 6 answers
2. asked by Katt<3Bobby
3. 738 views
Determine the pH (to two decimal places) of a solution prepared by adding 395 mL of 0.0360 M benzoic acid (C6H5COOH) to 12.5 g
1. 1 answer
2. asked by fati
3. 530 views
During a Breathalyzer Test it was determined that 1.60mg of K2Cr2O7 was consumed by the above reaction. Calculate the number of
1. 2 answers
2. asked by Jade
3. 1,748 views
I'm working on substitution organic chemistry problems and I just had a question.There's an equation in which a molecule is
1. 0 answers
2. asked by Jin
3. 523 views
A traveler required a total of 12 h on the round trip, averaging 20mi/h and 30 mi/h. Find a time in hours going using a T for
1. 1 answer
2. asked by ER
3. 326 views
the input to a 93.33 efficient belt drive system is 75 kw. what is the output ?
1. 1 answer
2. asked by pash
3. 512 views
What would you do in order to solve this question: "The enthalpy of combustion for benzoic acid is -3223.6kj/mol. Use the values
1. 1 answer
2. asked by Kylie
3. 1,480 views
What is the maximum amount of silver in grams that can be plated out of 3.8L of an AgNO3 solution containing 3.3% Ag by mass?(As
1. 1 answer
2. asked by Anonymous
3. 1,621 views
Find the percent of change when the price of a radio changes from $40.00 to $44.00.A, 12% B. 10% C. 36.4% D. 40% Is the answer
1. 1 answer
2. asked by Callie
3. 1,196 views
A 10kg mass is located at the (1.00m)i + (2.00m)j + (2.00m)k. A 5kg mass is located at (-1.00m)i + (1.00m)j + (1.00m)k.(A)
1. 0 answers
2. asked by Matt
3. 485 views
Solve for the unknown.1.) √y+√y+7=7 2.) √x+11=√x +1
1. 2 answers
2. asked by Janet
3. 387 views
find the measure of the central angle, where the pendulum of length 40cm travels an arc of 5cm as it swings through an angle
1. 1 answer
2. asked by deyanz
3. 591 views
I must complete an essay analyzing the atmosphere and how it's portrayed in Home for the Aged by Elizabeth Brewster.My question
1. 6 answers
2. asked by Bethany
3. 852 views
how do I solve quadratic equations by elimination?eg: 6x^2-3x=2y-5 2x^2+x=y-4
1. 1 answer
2. asked by Mistaking
3. 614 views
Juan lives 2.5 miles to the park. It took him 12 minutes to ride his bike to the park. What was his average speed in miles per
1. 8 answers
2. asked by Anne
3. 4,177 views
A 2.00kg solid sphere of radius 5.00cm rolls down a 20 degrees inclined plane starting from rest.(a) What is the magnitude of
1. 0 answers
2. asked by Nick
3. 939 views
Find the taylor polynomial of degree 3 for f(x)=1/x+2F(x)=-1/x+2)
1. 1 answer
2. asked by takunda
3. 1,063 views
I saw this problem half answered already but the answers I got were wrongA 238U nucleus is moving in the x-direction at
1. 1 answer
2. asked by James T.
3. 634 views
A 40.0 g block of ice at -15 degrees C is dropped into a calorimeter (of negligible heat capacity) containing water at 15
1. 3 answers
2. asked by Ciara
3. 3,109 views
MathThe Monahans have 21 meters of fencing with which to enclose a garden. If they plan to make the garden twice as long as it
1. 1 answer
2. asked by Vonna
3. 442 views
calculate the angular velocity in radians per minute of ferriswheel 250ft. in diameter that takes 45second to rotate once.
1. 1 answer
2. asked by deyanz
3. 861 views
A cylinder of gas is compressed by a piston from an intial volume of 125 litres to a final volume of 90 litres.The compression
1. 0 answers
2. asked by takunda
3. 528 views
A ray of light which is incident in air on the surface of the glass block is deviated through 15 degree. The angle of incidwnce
1. 0 answers
2. asked by Swati
3. 754 views
75.0 mL of a 1.40 M solution is diluted to a volume of 248 mL. A 124-mL portion of that solution is diluted using 165 mL of
1. 1 answer
2. asked by jessica
3. 508 views
what jobs did the people in the capitol have or what work did they do?
1. 1 answer
2. asked by cherry
3. 323 views
A point source of light is placed at the centre of the bottom of a jar having a liquid of refractive index 5/3.An opaque disc of
1. 1 answer
2. asked by Swati
3. 819 views
The ratio od boys to girls in the checkers club at Anastasia's school is equal to 2:3. The number od club memers is more than 20
1. 4 answers
2. asked by Javonte
3. 772 views
what was recreation like in the capitol compared to other districts!!! please help!!!
1. 1 answer
2. asked by susan
3. 353 views
A solution contains 3.10 g of solute in 10.4 g of solvent. What is the mass percent of the solute in the solution?
1. 1 answer
2. asked by karla
3. 777 views
While playing in a soccer match, Kevin ran from his end of the field to the opposing end and back 33 times. The field is 330
1. 2 answers
2. asked by Mike
3. 547 views
a 20 kg traveler's bag is being pulled along the floor with a force of 50 NF. the force is applied on the handle forming an
1. 3 answers
2. asked by jhon
3. 3,141 views
10 A color candy was chosen randomly out of a bag. Below are the results:Color Probability Blue 0.30 Red 0.10 Green 0.15 Yellow
1. 1 answer
2. asked by Den
3. 802 views
Robyn and Shruti both run on the cross country team. Robyn runs 2 miles every day. Shruti starts her week with a 3-mile run and
1. 1 answer
2. asked by Stephon
3. 597 views
A solution is prepared that contains 0.0200 M AgNO# and 0.150 M KSCN. What is the equilibrium concentration of Ag+ ion in this
1. 1 answer
2. asked by nns40760
3. 455 views
The acceleration of gravity is 9.8 m/s2 . What is the magnitude of the total force on a(n) 85 kg driver by the dragster he
1. 1 answer
2. asked by Edgar
3. 498 views
What is the theme of the poem Home for the Aged?Home For the Aged by Elizabeth Brewster: The old men sit, five of them on a
1. 3 answers
2. asked by Bethany
3. 2,523 views
b_n=(-2)^(n-1)
1. 1 answer
2. asked by Edward
3. 308 views
calculate the linear velocity of an object rotating at an angular velocity "w" at distance "r" from the center . express the
1. 2 answers
2. asked by deyanz
3. 1,036 views
please help me to solve this problem:calculate the angular velocity of a point for the given number of revolutions and time.
1. 1 answer
2. asked by deyanz
3. 580 views
What is the probability of obtaining tails and a sis?
1. 1 answer
2. asked by Maxine
3. 402 views
Calculate the standard entropy, ΔS°rxn, of the following reaction at 25.0 °C using the data in this table. The standard
1. 2 answers
2. asked by Patrick Panasko
3. 13,961 views
Determine the limit as x approaches 1 f(x) if f(x)={3-x, x does not equal 1 and 1, x=1A. 2 B. 1 C. 3/2 D. DNE E. None of these
1. 1 answer
2. asked by Anonymous
3. 315 views
The types of companies compete in the global marketplace: (1) international firms, (2) multinational firms, and (3)
1. 0 answers
2. asked by nafees
3. 760 views
Find f'(x) for f(x)=(2x^2+5)^7A. 7(4x)^6 B. 7(4x)^7 C. 28x(2x^2+5)^7 D. 7(2x^2+5)^6 E. None of these Would it be none of these
1. 0 answers
2. asked by Anonymous
3. 317 views
Find dy/dx if x^2+y^2=2xyA. x/(x-y) B. (y+x)/(y-x) C. 1 D. -x/y E. None of these Do I equal it to 0 and use implicit rule?
1. 0 answers
2. asked by Anonymous
3. 335 views
A 3.5 Liter sample of 5.8 M NaCL solution is diluted to 55 Liter. What is the molarity of the new solution?
1. 1 answer
2. asked by Anonymous
3. 537 views
Find limit as x approaches 1 5/(x-1)^2A. 0 B. Negative infinity C. 5/4 D. Infinity If I use limit as h approaches 0
1. 1 answer
2. asked by Anonymous
3. 592 views
A game is played by throwing darts at a target. A player can choose to throw two or three darts.Darcy plays two games. In Game
1. 0 answers
2. asked by Anonymous
3. 611 views
Find f'(x): f(x)=(x^2-3x)/x^2A. 2x-3/x^2 B. 2x-3/2x C. 1-(3/x) D. 3/x^2 E. None of these I can put it into the division rule for
1. 0 answers
2. asked by Anonymous
3. 386 views
Find limit as x approaches -1 (x^2+2x+3)/(x^2+1)A. 0 B. 1 C. Infinity D. DNE E. None of these
1. 0 answers
2. asked by Anonymous
3. 391 views
Find the derivative for f(x)=-x^2+xDo I put the -x^2 as a denominator? How would I solve it if that's what I'm supposed to do?
1. 0 answers
2. asked by Anonymous
3. 319 views
A) if you added 8g of ammonium nitrate to 25mL of room temperature water, what would be the temperature in °C?
1. 1 answer
2. asked by J
3. 582 views
how many grams of ammonium nitrate would you have to add to 25mL of room temperature water to get 36°F?
1. 1 answer
2. asked by Jay
3. 492 views
If f(x)=sin(2x), find f"(x)A. 2cos(2x) B. -4sin(2x) C. -2sin(2x) D. -4sinx E. None of these Is it B from using chain rules?
1. 0 answers
2. asked by Anonymous
3. 392 views
If f(x) = {x^2+3x-1, x<=2 and -3bx+3, x<2 , find the value of b in order for f to be continuous
1. 0 answers
2. asked by Anonymous
3. 334 views
If f(x) = {x^2+3x-1, x<=2 and -3bx+3, x<2 , find the value of b in order for f to be continuous
1. 0 answers
2. asked by Anonymous
3. 376 views
Find limit as x approaches 5 (x^2-3x-10)/(x-5)A. 2 B. DNE C. 0 D. 7 E. None of these
1. 0 answers
2. asked by Anonymous
3. 350 views
For which of these functions f(x) does limit as x approaches negative infinity f(x)=2A. (x-2)/(3x-5) B. 2x/sqrt(x-2) C.
1. 0 answers
2. asked by Anonymous
3. 623 views
Find values for x and/or y on the graph of x^2-2y^2+9x+8y-276=0 for which there is a vertical tangent line
1. 1 answer
2. asked by DJjazzyjazz
3. 457 views
Find an equation of the tangent line to the graph of f(x)=xsinx when x=0.A. y=0 B. f'(x)=0 C. y=xcosx+sinx D. y=x E. None of
1. 1 answer
2. asked by Anonymous
3. 461 views
Find dy/dx for y=sin(x+y)A. 0 B. (cos(x+y))/(1-cos(x+y) C. cos(x+y) D. 1 E. None of these I know I'm supposed to use implicit
1. 1 answer
2. asked by Anonymous
3. 545 views
if f(x) = 2x^2+4 and g(x)=x-3 which number satisfies f(x)= (f o g)(x)A) 3/2 B) 3/4 C) 5 D) 4 I am positive that answer A is
1. 1 answer
2. asked by Katie
3. 2,000 views
a car is running at 50 mph when the driver starts to step at the breaks. if the car decelerates at the rate of 7 ms^2, how long
1. 1 answer
2. asked by ynah
3. 569 views
a body moving at 40 m/s accelerates at the rate of 8m/s^2. what is the distance it transverses in 15 seconds?
1. 2 answers
2. asked by ynah
3. 393 views
Find the exact values of the six trigonometric functions for each of the following angles.draw the angles in standard position
1. 1 answer
2. asked by Jomar castillo
3. 568 views
Find d^2y/dx^2 for y=(x+3)/(x-1)A. 0 B. y=-8/(x-1)3 C. y=-4/(x-1)^3 D. y=8/(x-1)^3 E. None of these I got a positive number but
1. 1 answer
2. asked by Anonymous
3. 340 views
What traditions have grown around baseball?
1. 2 answers
2. asked by Just Wondering
3. 543 views
Which of the following describes the graph of y=|2x+6|?A. Only continuous B. Only differentiable C. Both A and B D. Not
1. 1 answer
2. asked by Anon
3. 676 views
A hollow sphere has a mass of 15 kg, an inner radius of 12 cm and an outer radius of 18 cm. What is the rotational inertia
1. 0 answers
2. asked by Mike
3. 542 views
a 20 kg traveler's bag is being pulled along the floor with a force of 50 NF. the force is applied on the handle forming an
1. 1 answer
2. asked by jhon
3. 641 views
Find f'(x) if f(x)=sin^3(4x)A. 4cos^3(4x) B. 3sin^2(4x)cos(4x) C. cos^3(4x) D. 12sin^2(4x)cos(4x) E. None of these I got D using
1. 1 answer
2. asked by Anonymous
3. 575 views
If f(1)=4 and f'(1)=2, find an equation of the tangent line at x=1A. y=2x+2 B. y=2x-2 C. y=4x-7 D. y=4x-2 E. None of these
1. 1 answer
2. asked by Anonymous
3. 460 views
ABC*AA Ans: AC6C Find ABC values?
1. 0 answers
2. asked by Kamalakshi
3. 500 views
a peak is sighted at an angle of 27 degree 45 min. 1000ft nearer its angle of elevation is 31 degree 30 min.find the height of
1. 1 answer
2. asked by chel
3. 427 views
A prism has a base which is a right triangle with legs, 16mm and 12 mm
1. 1 answer
2. asked by sawsdas
3. 407 views
An unknown mass of a certain solid, initially at 60⁰C, is heated at a uniform at a uniform rate. After 4.0 min the solid
1. 3 answers
2. asked by Alicia
3. 700 views
The area of a regular hexagon inscribed in a circle is equal to 166.28 square cm. If the circle is inscribed in a square, find
1. 2 answers
2. asked by Sol
3. 2,742 views
A company has been studying the performance of their sales department. The measure of performance used is: average monthly sales
1. 1 answer
2. asked by Deeptimaan
3. 587 views
An air gap exists between fluids in a bottle and the cap of the bottle. At a firm producing olive oil, the gap is critical to
1. 3 answers
2. asked by Deeptimaan
3. 1,064 views
The s of a bullet of mass 20g in 216km/s what is kinetic energy
1. 1 answer
2. asked by Shedrack
3. 1,104 views
How to find a keywords of the quote our deepest fear
1. 1 answer
2. asked by Anonymous
3. 402 views
a force of 10n cause a spring to extened by 20 mm find? the extension of the spring when 25n is applied
1. 19 answers
2. asked by mubarak
3. 7,370 views
. In Griswold v. Connecticut, the Supreme Court was considered an activist court because...I know that it has everything to do
1. 2 answers
2. asked by Sunflower
3. 659 views
a projectile has a maximum range R=150m.find its initial velocity and the corresponding maximum height it reaches. at what angle
1. 1 answer
2. asked by ali
3. 480 views
an object moves horizontally with a velocity v=20m/s with constant acceleration a=2m/ss.how faar does it move before its
1. 1 answer
2. asked by ali
3. 384 views
Genome A5�-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC
1. 0 answers
2. asked by Jessica
3. 619 views
Comparisons between Lady Macbeth and Juliet + some quotes to explain the comparisons
1. 1 answer
2. asked by Hifza
3. 681 views
The Jolliebee hamburger chain specializes in half-pound hamburgers. The sales follow a normal distribution. The standard
1. 0 answers
2. asked by Jennifer
3. 456 views
A river is flowing along the east direction with a velocity of 10km/hr. A person heads towards north with a velocity of 2km/hr.
1. 1 answer
2. asked by shreya
3. 1,014 views
Kendra has a painting canvas that is 27 inches wide by 33 inches high. She painted a red rose, which covered 40% of the canvas.W
1. 3 answers
2. asked by jamie
3. 891 views
Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60
1. 1 answer
2. asked by Anonymous
3. 542 views
Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60
1. 1 answer
2. asked by Anonymous
3. 567 views
I did a titiration expriment and I needto work out how much Hcl is in the sample (NaOH). The expriment was testing the rate of
1. 1 answer
2. asked by annnnnnnnnnnnnnnnnn
3. 480 views

Back to November 2014

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2024