Archives
2014
November

Questions Asked on November 30, 2014

Calculate the standard entropy, ΔS°rxn, of the following reaction at 25.0 °C using the data in this table. The standard
1. 2 answers
2. asked by Patrick Panasko
3. 14,014 views
A circle having an area of 452 square inches is cut into two segments by a chord, which is 6 inches from the center of the
1. 2 answers
2. asked by Sol
3. 11,632 views
Sean has 8-inch pieces of toy train track and Ruth has 18-inches of train track. How many of each piece would each child need to
1. 9 answers
2. asked by Anonymous
3. 9,873 views
The ratio of cups of water to cups of milk in a recipe is 1 to 3. Write three ratios equivalent to the ratio?
1. 17 answers
2. asked by jordon
3. 7,842 views
a force of 10n cause a spring to extened by 20 mm find? the extension of the spring when 25n is applied
1. 19 answers
2. asked by mubarak
3. 7,403 views
What are possible ratios of wins to losses for a basketball team?
1. 0 answers
2. asked by Stephon
3. 5,663 views
Find all points on the graph of f(x)=-x^3+3x^2-2 where there is a horizontal tangent line.
1. 3 answers
2. asked by Sarah
3. 5,208 views
A popular resort hotel has 300 rooms and is usually fully booked. About 4% of the time a reservation is cancelled before 6:00 PM
1. 1 answer
2. asked by Richa
3. 4,253 views
Which of the expressions is not equivalent to 1/25?A. 5^3×5^-5 B. 5^-1×5^-1 C. 5^-3×5 D. 5^-2×5^4
1. 4 answers
2. asked by Anon
3. 4,209 views
Juan lives 2.5 miles to the park. It took him 12 minutes to ride his bike to the park. What was his average speed in miles per
1. 8 answers
2. asked by Anne
3. 4,208 views
A man walks across a bridge at the rate of 5 ft/s as a boat passes directly beneath him at 10 ft/s. If the bridge is 10 ft above
1. 1 answer
2. asked by ray
3. 3,534 views
a 20 kg traveler's bag is being pulled along the floor with a force of 50 NF. the force is applied on the handle forming an
1. 3 answers
2. asked by jhon
3. 3,180 views
A 40.0 g block of ice at -15 degrees C is dropped into a calorimeter (of negligible heat capacity) containing water at 15
1. 3 answers
2. asked by Ciara
3. 3,144 views
evaluate the surface integraldouble integral (y dS) z= 2/3 (x^3/2 + y^3/2) 0 ≤ x ≤ 5, 0 ≤ y ≤ 2
1. 2 answers
2. asked by sara
3. 2,833 views
The area of a regular hexagon inscribed in a circle is equal to 166.28 square cm. If the circle is inscribed in a square, find
1. 2 answers
2. asked by Sol
3. 2,773 views
What is the theme of the poem Home for the Aged?Home For the Aged by Elizabeth Brewster: The old men sit, five of them on a
1. 3 answers
2. asked by Bethany
3. 2,543 views
The acceleration of gravity is 9.8 m/s^2 . What is the magnitude of the total force on a(n) 72 kg driver by the dragster he
1. 4 answers
2. asked by Jackie
3. 2,457 views
Consider the reaction for the production of NO2 from NO:2 NO(g) + O2(g) = 2 NO2(g) a)If 84.8L of O2(g), measured at 35 degrees
1. 2 answers
2. asked by Kirsty
3. 2,391 views
A solid has a base bounded by x^2_y^2=36. Find the volume of the solid if every plane section perpendicular to the diameter is
1. 1 answer
2. asked by Trinh
3. 2,319 views
Find the derivative of x^2f(x)A. x[xf'(x)+2f(x)] B. 2xf'(x) C. x[xf'(x) +2f'(x)] D. x^2f'(x) E. None of these
1. 1 answer
2. asked by Anonymous
3. 2,242 views
Find an equation of the tangent line to the graph of x^2+3y^2=4 at the point (1,1)A. y+1=-1/3(x+1) B. y-1=-x/3y(x-1) C. x+3y=2
1. 1 answer
2. asked by Anonymous
3. 2,063 views
if f(x) = 2x^2+4 and g(x)=x-3 which number satisfies f(x)= (f o g)(x)A) 3/2 B) 3/4 C) 5 D) 4 I am positive that answer A is
1. 1 answer
2. asked by Katie
3. 2,028 views
A car starting at 12:00 noon travels west at a speed of 30 kph. Another car starting from the same point at 2:00 PM travels
1. 1 answer
2. asked by @jayr
3. 1,930 views
During a Breathalyzer Test it was determined that 1.60mg of K2Cr2O7 was consumed by the above reaction. Calculate the number of
1. 2 answers
2. asked by Jade
3. 1,768 views
What is the maximum amount of silver in grams that can be plated out of 3.8L of an AgNO3 solution containing 3.3% Ag by mass?(As
1. 1 answer
2. asked by Anonymous
3. 1,648 views
In a Map a distance of 50KM between two places A and B represented by 4m. What will be the actual distance between A and C,
1. 4 answers
2. asked by niya
3. 1,648 views
the ratio of boys to girls on the bus is 20/15. what are three ratio equivalents.
1. 5 answers
2. asked by jordon
3. 1,623 views
The ratio of boys to girls at a day care cent is 5 to 4. Which of the following cannot be the total number of children at the
1. 5 answers
2. asked by Stephon
3. 1,565 views
What would you do in order to solve this question: "The enthalpy of combustion for benzoic acid is -3223.6kj/mol. Use the values
1. 1 answer
2. asked by Kylie
3. 1,507 views
A simple random sample of students is selected, and the students are asked how much time they spentpreparing for a test. The
1. 2 answers
2. asked by Brian
3. 1,506 views
Find the percent of change when the price of a radio changes from $40.00 to $44.00.A, 12% B. 10% C. 36.4% D. 40% Is the answer
1. 1 answer
2. asked by Callie
3. 1,216 views
-Athens does not live up to Pericles ideal democracy because Athenians use of ostracism contradicts Pericles statement that all
1. 26 answers
2. asked by Nicole
3. 1,168 views
The s of a bullet of mass 20g in 216km/s what is kinetic energy
1. 1 answer
2. asked by Shedrack
3. 1,131 views
An air gap exists between fluids in a bottle and the cap of the bottle. At a firm producing olive oil, the gap is critical to
1. 3 answers
2. asked by Deeptimaan
3. 1,093 views
Find the taylor polynomial of degree 3 for f(x)=1/x+2F(x)=-1/x+2)
1. 1 answer
2. asked by takunda
3. 1,084 views
calculate the linear velocity of an object rotating at an angular velocity "w" at distance "r" from the center . express the
1. 2 answers
2. asked by deyanz
3. 1,067 views
A child of mass m is playing on a merry-go-round which has mass 6m and radius r. Assume the merry-go-round is a uniform disk.
1. 1 answer
2. asked by Alex
3. 1,052 views
A river is flowing along the east direction with a velocity of 10km/hr. A person heads towards north with a velocity of 2km/hr.
1. 1 answer
2. asked by shreya
3. 1,036 views
What is the riddle for moving words
1. 4 answers
2. asked by Chris
3. 1,032 views
A jellyfish can propel itself with jets of water pushed out of its bell, a flexible structure on top of its body. The elastic
1. 0 answers
2. asked by Jason
3. 1,024 views
A 2.00kg solid sphere of radius 5.00cm rolls down a 20 degrees inclined plane starting from rest.(a) What is the magnitude of
1. 0 answers
2. asked by Nick
3. 966 views
Tarot cards are used for telling fortunes, and in a reading, the arrangement of the cards is as important as the cards
1. 1 answer
2. asked by libby
3. 954 views
Suppose that h is a function with h'(x) = xe^x. Find all intervals where the function h is concave up.Now, I understand that
1. 1 answer
2. asked by Brian
3. 924 views
Kendra has a painting canvas that is 27 inches wide by 33 inches high. She painted a red rose, which covered 40% of the canvas.W
1. 3 answers
2. asked by jamie
3. 916 views
The addition of a crystal of sodium chlorate to a sodium chlorate solution containing no undissolved solute causes additional
1. 1 answer
2. asked by Ang
3. 910 views
I must complete an essay analyzing the atmosphere and how it's portrayed in Home for the Aged by Elizabeth Brewster.My question
1. 6 answers
2. asked by Bethany
3. 879 views
calculate the angular velocity in radians per minute of ferriswheel 250ft. in diameter that takes 45second to rotate once.
1. 1 answer
2. asked by deyanz
3. 871 views
I figured out that part "A" is -3/8, but i can't figure out part 2, a or b. please explain and help. thanks.Sand is falling from
1. 2 answers
2. asked by Jake
3. 867 views
When a 1.50 kg block is 3.96 m above the base of the hill, the mass has a speed of 1.71 m/s. When the block reaches a point
1. 2 answers
2. asked by Steve
3. 865 views
Find the derivative: f(x)=1/cubed root(3-x^3)A. -1/3(3-x^3)^4/3 B. x^2/(3-x^3)^4/3 C. -x^2/(3-x^3)^2/3 D. -x^2/(3-x^3)^4/3 E.
1. 3 answers
2. asked by Anonymous
3. 863 views
Let f(7)=0, f'(7)=14, g(7)=1, g'(7)=1/7. Find h'(7) if h(x)=f(x)/g(x)
1. 1 answer
2. asked by Sarah
3. 862 views
10 A color candy was chosen randomly out of a bag. Below are the results:Color Probability Blue 0.30 Red 0.10 Green 0.15 Yellow
1. 1 answer
2. asked by Den
3. 846 views
A point source of light is placed at the centre of the bottom of a jar having a liquid of refractive index 5/3.An opaque disc of
1. 1 answer
2. asked by Swati
3. 838 views
Robyn and Shruti both run on the cross country team. Robyn runs 2 miles every day. Shruti starts her week with a 3-mile run and
1. 3 answers
2. asked by Jamar
3. 815 views
The ratio od boys to girls in the checkers club at Anastasia's school is equal to 2:3. The number od club memers is more than 20
1. 4 answers
2. asked by Javonte
3. 799 views
A solution contains 3.10 g of solute in 10.4 g of solvent. What is the mass percent of the solute in the solution?
1. 1 answer
2. asked by karla
3. 798 views
The types of companies compete in the global marketplace: (1) international firms, (2) multinational firms, and (3)
1. 0 answers
2. asked by nafees
3. 797 views
A ray of light which is incident in air on the surface of the glass block is deviated through 15 degree. The angle of incidwnce
1. 0 answers
2. asked by Swati
3. 789 views
In radiation therapy,a.isotopes are traced through a chemical reaction. b.unhealthy human cells are destroyed. c.radioactive
1. 6 answers
2. asked by Katt<3Bobby
3. 762 views
A puck (uniform disk) of mass m and radius r is travelingat a speed v on frictionless ice. It strikes a second identical puck a
1. 0 answers
2. asked by Alex
3. 736 views
An unknown mass of a certain solid, initially at 60⁰C, is heated at a uniform at a uniform rate. After 4.0 min the solid
1. 3 answers
2. asked by Alicia
3. 727 views
A half of a pepperoni stick is 10 cm long. Assume that a cross section perpendicular to the axis of the pepperoni at a distance
1. 1 answer
2. asked by Trinh
3. 722 views
The theme is the theme is thoughts of elderly? And that there is only one life to live so live it well? This poem seems
1. 4 answers
2. asked by Bethany
3. 708 views
A 4 to 7 month old baby sleeps an average of 14 hours per day. At this age, babies sleep patterns follow normal distribution
1. 0 answers
2. asked by adriana
3. 706 views
Which of the following describes the graph of y=|2x+6|?A. Only continuous B. Only differentiable C. Both A and B D. Not
1. 1 answer
2. asked by Anon
3. 704 views
Comparisons between Lady Macbeth and Juliet + some quotes to explain the comparisons
1. 1 answer
2. asked by Hifza
3. 703 views
similarities and differences between lady macbeth and juliet
1. 1 answer
2. asked by Rais
3. 701 views
. In Griswold v. Connecticut, the Supreme Court was considered an activist court because...I know that it has everything to do
1. 2 answers
2. asked by Sunflower
3. 696 views
(7.8*10 to the 12th power)*800=(7.8*10 to the 10th power)*80,000Directions:tell whether each equation is true or false. if
1. 2 answers
2. asked by Bob
3. 685 views
A 4.26 kg block starts up a 33.0 degree incline at 7.81 m/s. How far will it slide if the coefficient of kinetic friction is
1. 1 answer
2. asked by Jennifer
3. 675 views
a 20 kg traveler's bag is being pulled along the floor with a force of 50 NF. the force is applied on the handle forming an
1. 1 answer
2. asked by jhon
3. 669 views
A game is played by throwing darts at a target. A player can choose to throw two or three darts.Darcy plays two games. In Game
1. 0 answers
2. asked by Anonymous
3. 662 views
I saw this problem half answered already but the answers I got were wrongA 238U nucleus is moving in the x-direction at
1. 1 answer
2. asked by James T.
3. 653 views
For which of these functions f(x) does limit as x approaches negative infinity f(x)=2A. (x-2)/(3x-5) B. 2x/sqrt(x-2) C.
1. 0 answers
2. asked by Anonymous
3. 652 views
Genome A5�-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC
1. 0 answers
2. asked by Jessica
3. 646 views
in Greek education why is it beneficial to educate all children in a civilization? why is it important to educate the population
1. 8 answers
2. asked by Daniela
3. 645 views
Evaluate the expression.11! 6! 4! 2! 3! 1!
1. 1 answer
2. asked by libby
3. 641 views
Find limit as x approaches 1 5/(x-1)^2A. 0 B. Negative infinity C. 5/4 D. Infinity If I use limit as h approaches 0
1. 1 answer
2. asked by Anonymous
3. 640 views
how do I solve quadratic equations by elimination?eg: 6x^2-3x=2y-5 2x^2+x=y-4
1. 1 answer
2. asked by Mistaking
3. 632 views
The staff of the Westpoint Public Library signed up 6 volunteers in the last 21 days. If the library staff continues to sign up
1. 2 answers
2. asked by Stephon
3. 628 views
A weak acid, HA, has an ionization constant of 9.29 x 10-6. If we prepare a solution that is 0.727 M in HA what percent of the
1. 1 answer
2. asked by jess
3. 626 views
Robyn and Shruti both run on the cross country team. Robyn runs 2 miles every day. Shruti starts her week with a 3-mile run and
1. 1 answer
2. asked by Stephon
3. 622 views
A 4 to 7 month old baby sleeps an average of 14 hours per day. At this age, babies sleep patterns follow normal distribution
1. 1 answer
2. asked by adriana
3. 619 views
A dude is spinning a 1.0 kg mass on the end of a 1.5 meter string. He gets it spinning at a constant rate of 4.0 rev/sec. The
1. 0 answers
2. asked by hicham
3. 616 views
A) if you added 8g of ammonium nitrate to 25mL of room temperature water, what would be the temperature in °C?
1. 1 answer
2. asked by J
3. 612 views
A company has been studying the performance of their sales department. The measure of performance used is: average monthly sales
1. 1 answer
2. asked by Deeptimaan
3. 612 views
find the measure of the central angle, where the pendulum of length 40cm travels an arc of 5cm as it swings through an angle
1. 1 answer
2. asked by deyanz
3. 606 views
Find the linearization of f(x)=cos(x)-sin(2x) at x = 0.
1. 1 answer
2. asked by Fred
3. 604 views
please help me to solve this problem:calculate the angular velocity of a point for the given number of revolutions and time.
1. 1 answer
2. asked by deyanz
3. 602 views
Find f'(x) if f(x)=sin^3(4x)A. 4cos^3(4x) B. 3sin^2(4x)cos(4x) C. cos^3(4x) D. 12sin^2(4x)cos(4x) E. None of these I got D using
1. 1 answer
2. asked by Anonymous
3. 601 views
Find the exact values of the six trigonometric functions for each of the following angles.draw the angles in standard position
1. 1 answer
2. asked by Jomar castillo
3. 600 views
Find limit as x approaches 5 (x^2-3x-10)/(x-5)
1. 1 answer
2. asked by Anonymous
3. 595 views
Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60
1. 1 answer
2. asked by Anonymous
3. 593 views
a car is running at 50 mph when the driver starts to step at the breaks. if the car decelerates at the rate of 7 ms^2, how long
1. 1 answer
2. asked by ynah
3. 586 views
While playing in a soccer match, Kevin ran from his end of the field to the opposing end and back 33 times. The field is 330
1. 2 answers
2. asked by Mike
3. 575 views
Find the height of a ball after 3 seconds, if the ball is hit with an initial velocity of 90 feet per second at an angle of 60
1. 1 answer
2. asked by Anonymous
3. 574 views
Postwar America (1918-1920) faced social change. Explain in 3-5 sentences the changes that occurred at this time.
1. 2 answers
2. asked by Daniel
3. 569 views
For the function: f(x)= 2+x-x^2/ (x-1)^2 ; f'(x)= x-5/(x-1)^3 ; f''(x)=2x-14/(x-1)^4a)find vertical and horizontal asymptotes.
1. 1 answer
2. asked by Sarah
3. 569 views
How much work is required to extend an exercise spring 15cm if the spring constant is 800N/m?
1. 1 answer
2. asked by Leah
3. 569 views
Find dy/dx for y=sin(x+y)A. 0 B. (cos(x+y))/(1-cos(x+y) C. cos(x+y) D. 1 E. None of these I know I'm supposed to use implicit
1. 1 answer
2. asked by Anonymous
3. 568 views

Back to November 2014

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025