Archives
2013
June

Questions Asked on June 8, 2013

Dr BobCan you please assist Redox balancing in BASIC sol. NO2- +Al-->NH3 +Al(OH)4- if you could please walk through step by
1. 6 answers
2. asked by Steve
3. 3,393 views
The financial loss that each stockholder in a corporation can incur is usually limited to the amount invested by the
1. 0 answers
2. asked by TS
3. 509 views
Temporary investmentsA.are reported as current assets B.include cash equivalents C.do not include equity securities D.all of the
1. 1 answer
2. asked by TS
3. 1,435 views
6. -2r(8r + 5)a -16r2 + 5 b -16r2 +10 c -16r2 -10r d -16r2 - 10 7. 4a (a2 + 7a + 4 a 4a + 28a2 + 16a b 4a3 +28a2 +16a c 4a3 +
1. 17 answers
2. asked by swaggy
3. 2,687 views
In which of the following sentences doe you find a verb phrase?A. I shall be all that I am and more B. June was a collector of
1. 3 answers
2. asked by Jen
3. 517 views
I need some help with these quesitons1. a1 = -1, and an = 4/3an-1 for n = 2, 3, 4, ___. What is the common ration, r, for this
1. 4 answers
2. asked by mysterychicken
3. 608 views
Hello, I have Business and Technical Writing paper and it has me a little stumpped. I just don't know how I can fill the
1. 1 answer
2. asked by Adrienne
3. 603 views
Which of the selections below denotes an Excel formula to add up the data valued within cells D2 through D10?
1. 1 answer
2. asked by Anonymous
3. 378 views
How is man shaped by the times in which they live. An example of Hitler, Mlk or LBJ, or any leader that was shaped by the times
1. 1 answer
2. asked by renee
3. 325 views
literature can help learn to clarify problems and:
1. 1 answer
2. asked by tasha
3. 386 views
At the market close on February 19, 2010, McDonald's Corporation had a closing stock price of $64.74. In addition, McDonald's
1. 21 answers
2. asked by TS
3. 538 views
What is the total stockholders' equity based on the following account balances?Common Stock $450,000 Paid-In Capital in Excess
1. 1 answer
2. asked by TS
3. 6,126 views
an electron with a speed of 5.00 x 10^8 cm/s enters an electric field of magnitude 1.00 x 10^3 N/C, traveling along field lines
1. 1 answer
2. asked by Anonymous
3. 3,088 views
Samuels, Inc. reported net income for 2011 is $105,000. During 2011 the company had 5,000 shares of $100 par, 5% preferred stock
1. 1 answer
2. asked by TS
3. 421 views
Multipling polynomials: 3x+5yards +3x-5 yards
1. 2 answers
2. asked by Jay
3. 315 views
which sample (salt,fertilizer and sulfuric acid) will have the most algae growth? and why ?which sample (salt,fertilizer and
1. 0 answers
2. asked by john
3. 340 views
identify the variable, population and is this quantitative or qualitative The archaeological site of Tara is more than 4000
1. 4 answers
2. asked by marie
3. 1,892 views
Can anyone please assist showing half reactions balancing, balancing of e- and the additions of H2O, H+ and then since its
1. 1 answer
2. asked by Steve
3. 499 views
the speed of a boat increases from 62 km/h to 80 km/h in 0.9km. What was the acceleration and how long did it take
1. 1 answer
2. asked by ebere
3. 305 views
the rays won 33 fewer games than twice as many games as they lost. the total games played was 162. how many wins and how many
1. 1 answer
2. asked by Jesse
3. 469 views
Calculate the approximate boiling point of a mixture of bromobenzene and waterat atmospheric pressure. A table of vapor pressure
1. 1 answer
2. asked by victoria
3. 2,016 views
Calculate the weight of benzene codistilled with each gram of water and the percentagecomposition of the vapor produced during a
1. 2 answers
2. asked by victoria
3. 1,677 views
as the nightingale write the diary entry highlighting her fears and analyzing the reasons for her failure-the frog and the
1. 1 answer
2. asked by sakthi
3. 637 views
Ned’s Sheds purchases building materials from Timbertown Lumber for $3,700 with terms of 4/15, n/30. The invoice is dated
1. 0 answers
2. asked by douny
3. 533 views
Carolyn tested a coin to see if it was evenly weighted. She flipped the coin 100 times and came up with 42 heads and 58 tails.
1. 0 answers
2. asked by bubbie
3. 623 views
a mouse gathered 32 graph paper squares each one had a side of 1cm she used them to cover a floor it was a rectangle twice as
1. 0 answers
2. asked by jen
3. 410 views
Jane spins the spinner 10 times in succession.Seven times the spinner lands on an even number. What is the relative frequency
1. 1 answer
2. asked by bubbie
3. 604 views
the sum of two numbers is 38 . the larger number is 11 more than the half of the smaller number. what are the two numbers?
1. 1 answer
2. asked by urvi
3. 1,423 views
If the markup of a fluorescent light fixture transformer is 120% based on the cost, what is the corresponding percent markup
1. 0 answers
2. asked by douny
3. 633 views
At The Luminary, the markup on a halogen light fixture is 50% based on selling price. What is the corresponding percent markup
1. 0 answers
2. asked by douny
3. 609 views
height shoe size (if you wear men's shoes, add 2)61 6.5 67 9 63 7 66 8 60 6 71 10 71 11 63 8 63 7 66 62 7 64 6.5 61 7 64 7.5 63
1. 5 answers
2. asked by Armando
3. 393 views
Can't figure out equationx/2+x/3=3/4 can you help me step by step.
1. 1 answer
2. asked by Jessica
3. 306 views
City Cellular purchased $28,900 in cell phones on April 25. The terms of sale were 4/20, 3/30, n/60. Freight terms were F.O.B.
1. 0 answers
2. asked by douny
3. 815 views
An invoice is dated August 29 with terms of 4/15 EOM. What is the discount date? (Points : 2.5)12. What is the net date for the
1. 2 answers
2. asked by douny
3. 751 views
A polynomial f(x) of degree 3 leaves a remainder of 6 when divided by (x+1) and a remainder of 12 when divided by (x-2). Given
1. 0 answers
2. asked by Everett
3. 446 views
What is the net price factor for trade discounts of 25/15/10? (Points : 2.5)
1. 1 answer
2. asked by douny
3. 459 views
Fandango Furniture Manufacturing, Inc. has 40 employees on the assembly line, each with gross earnings of $325 per week. What
1. 1 answer
2. asked by douny
3. 501 views
17. Fandango Furniture Manufacturing, Inc. has 40 employees on the assembly line, each with gross earnings of $325 per week.
1. 4 answers
2. asked by douny
3. 1,052 views
A clause from sentence (I) has been turned into a (n) _____ in sentence (ii).(i) Since she knew what the lecture was about, she
1. 2 answers
2. asked by Jen
3. 406 views
What is the factor of safety of a steel hanger having an ultimate strength of 550.000MPa and supporting a load of 64000.000N.
1. 0 answers
2. asked by Danny
3. 384 views
A uniform sheet of surface current density Ks=Ky ay in z=0 plane. find the magnetic field strength H everywhere using ampere's
1. 0 answers
2. asked by amgad
3. 433 views
Which one of the following is a complex sentence?A. I would like to visit the Kinshasa, but I understand the city is unsafe for
1. 1 answer
2. asked by Jen
3. 403 views
A jar contains 2 orange balls, 5 black balls, and 3 pink balls.Event A = drawing a black ball on the first draw Event B =
1. 2 answers
2. asked by bubbie
3. 1,175 views
Suppose that A and B are events defined on a common sample space and that the following probabilities are known. Find P(A or B).
1. 0 answers
2. asked by Carl
3. 573 views
Use the four-step process to find the slope of the tangent line to the graph of the given function at any point.f(x) = 16 - 10 x
1. 1 answer
2. asked by Shan
3. 1,999 views
1. A train traveling at a speed of 110km/h decelerates for 20 seconds. During that time it travels 450 meters.A) What is the
1. 2 answers
2. asked by Danny
3. 470 views
For how many ordered pairs of positive integers n and k with n and k less than or equal to 20, is the number((2n)!(2k)!) /
1. 3 answers
2. asked by keshav
3. 702 views
Chef Fabio went to the store and bought 2 cans of beans, 2 cans of tomatoes, and 2 cans of tuna, all of which were the same
1. 4 answers
2. asked by parishi
3. 599 views
Entries for Stock DividendsOrganic Life Co. is an HMO for businesses in the Portland area. The following account balances appear
1. 0 answers
2. asked by Anonymous
3. 513 views
Two identical twins, Amy and Beatrice, are on top of two different slides, one on each slide. Both slides start 3 m above the
1. 2 answers
2. asked by keshav
3. 750 views
Effect of Stock SplitGino's Restaurant Corporation wholesales ovens and ranges to restaurants throughout the Midwest. Gino's
1. 2 answers
2. asked by Shan
3. 1,941 views
EPSMalen Arts, Inc., had earnings of $133,750 for 2012. The company had 25,000 shares of common stock outstanding during the
1. 0 answers
2. asked by Shan
3. 568 views
Workers who wash windows or paint the outside of buildings use an interesting contraption known as a painter's lift. This
1. 2 answers
2. asked by keshav
3. 1,091 views
Can you check my work?If Angelona's weekly allowance is d dollars, which Expression represents her allowance, in Dollars, for x
1. 1 answer
2. asked by Es
3. 1,110 views
I'm trying to find the radius of convergence for$(x-2)^n/(2x+1) I did the ratio test and ended up with: absolute
1. 1 answer
2. asked by Steven
3. 949 views
e.g. I want to find out more about the smart phone.(In this sentence, what is the part of speech of 'more' Is 'more a noun, a
1. 1 answer
2. asked by rfvv
3. 365 views
1. My goal is to read 100 books this year.2. My goal is reading 100 books this year. (Are both grammatical? Which one is
1. 1 answer
2. asked by rfvv
3. 362 views
1. Would you like to go to the movie?2. Would you like to go to the movies? (Are both grammatical? Do we have to use only 'the
1. 1 answer
2. asked by rfvv
3. 433 views
Universal Exporting has three warehouse employees: John Abner earns $422 per week, Anne Clark earns $510 per week, and Todd
1. 2 answers
2. asked by Taylor
3. 1,061 views
Grosse Männer müssen ______ öfter rasieren als Jungs.sie sich es ihn
1. 1 answer
2. asked by bubbie
3. 502 views
Posted by Nora 56 on Sunday, June 2, 2013 at 7:32pm.Sorry to repost but no one answered after I posted on the 2nd,please help,
1. 0 answers
2. asked by Nora 56
3. 502 views
a bowling ball with a mass of 10 kg and a bowling pin with a mass of 0.5kg, are standing 2m apart, from centre to centre. what
1. 0 answers
2. asked by wendy Thomas
3. 415 views
(c) The number of cars found to have unsafe tires among the 379 cars stopped at a roadblock for inspection (assume that 15% of
1. 4 answers
2. asked by tommy512
3. 1,095 views
The survival rate during a risky operation for patients with no other hope of survival is 87%. What is the probability that
1. 4 answers
2. asked by Gayle 58
3. 3,117 views
x is a binomial random variable. (Give your answers correct to three decimal places.)(e) Calculate the probability of x for: n =
1. 1 answer
2. asked by Gayle 57
3. 623 views
the probability of passing an examination is 0.8 what is the probability of failing the examination
1. 4 answers
2. asked by abdulsamad
3. 1,052 views
In the computer game, there must be a ramp that is 2 m wide, with height 3 m and length. 5 m. Assume that one corner of the
1. 0 answers
2. asked by ashley
3. 435 views
11/16-12/16
1. 1 answer
2. asked by jorge
3. 232 views
Suppose 2 rats die in the first 4hours. What is the probability that 2 or fewer rats will die in the next 4 hours.
1. 0 answers
2. asked by Cathy
3. 473 views
Test the potency of a drug on 20 rats. Previous animal show that a 10-mg dose of drug is lethal 5% of the time within 1st 4
1. 0 answers
2. asked by Cathy
3. 428 views
plz give me solutions of 10 class bbc compehensions answers
1. 1 answer
2. asked by joe
3. 304 views
Find the median and the mean for the data set below.5.4 2.0 6.8 3.1 2.9 4.7 2.1 5.0 1.9 3.4
1. 2 answers
2. asked by john
3. 713 views
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
2. asked by ISSY
3. 450 views
Another Redox in BASIC ....having a tough time with these OH's no clue how to tackle.Cr(OH)3 + ClO^- => CrO4^2- +Cl2 thanks for
1. 1 answer
2. asked by Steve
3. 362 views
calculate the rate constant at 225C for a reaction that has a rate constant of 8.1X10^-4 at 95c and an activation enegry of 93.0
1. 2 answers
2. asked by Jason
3. 2,089 views
Let f(x)=−4−3x+2x^2. Use the limit definition of the derivative to find find f�Œ(a)
1. 1 answer
2. asked by Robin
3. 397 views
We did not find results for: High temperatures in a certain city for the month of August follow a uniform distribution over the
1. 2 answers
2. asked by Latesha
3. 3,747 views
What would happen when a dipole is placed in uniform electric field making an angle theta with the direction of electric field ?
1. 1 answer
2. asked by Sneha
3. 378 views
express as a decimal correct to four decimal places:16%
1. 1 answer
2. asked by sigfreid
3. 461 views
Two points X and Y in the xy plane have coordinates (10,5) and (a,b), respectively. The midpoint of the line segment XY has
1. 0 answers
2. asked by vranda
3. 395 views
You are planning to lay square tiles on an entire 21125cm by 54925cm rectangular floor without any overlapping. If all the
1. 0 answers
2. asked by vranda
3. 424 views
Triangle ABC has an obtuse angle at B, base BC has length equal to 30 and height equal to 24. (This height is taken with respect
1. 2 answers
2. asked by keshav
3. 973 views
The integers from 1 through 10 (inclusive) are divided into three groups, each containing at least one number. These groups
1. 3 answers
2. asked by keshav
3. 574 views
1.what are amber light from traffic signal?2. what are cosmic rays from outer space?
1. 0 answers
2. asked by nick
3. 344 views
What would happen when a dipole is placed in uniform electric field making an angle theta with the direction of electric field ?
1. 1 answer
2. asked by Aman
3. 387 views
find the absolute maximum and minimum of sqrt 3 x^2/36 + (1-x)^2/32
1. 1 answer
2. asked by stan
3. 395 views

Back to June 2013

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2024