Archives
2011
June

Questions Asked on June 10, 2011

a runner training for a race times her 400 meter laps around a track. her times are lap 1 60 seconds, lap 2 57 seconds, lap 3 55
1. 2 answers
2. asked by Quetta
3. 5,526 views
what is the power dissipated by a 10 ohm resistor through which a 2 ampere current is flowing?
1. 1 answer
2. asked by harold
3. 3,983 views
In a binomial distribution:A) the random variable X is continuous. B)the probability of event of interest (pie symbol)is stable
1. 2 answers
2. asked by Allen
3. 3,357 views
21) The number of oil spills occurring off the Alaskan coastA) Discrete B) Continuous Find the odds. 22) When a single card is
1. 5 answers
2. asked by candy
3. 3,312 views
a force f= 3i+cj+2k acting on a particle causes displacement , d=-4i+2j+3k.If the work done is 6 joule then the value of c. Plz.
1. 2 answers
2. asked by marley
3. 3,281 views
The cost of new homes is high today. Many people are purchasing older homes in need of renovation.the most effective combination
1. 7 answers
2. asked by Ruth
3. 2,636 views
I need to make an acrostic poem for science. My teacher said that each letter needs to start a sentence about plant life. The
1. 10 answers
2. asked by Hanna
3. 2,549 views
A cylindrical copper cable 1.50Km long is connected across a 220.0V potential difference.(a) What should be its diameter so that
1. 1 answer
2. asked by Rohan Khan
3. 2,407 views
Which of the following represents a direct variation function?The answer coices are A)d=2r B)y=9x+1 C)y=-3 D)a=1/2h(b1+b2)
1. 3 answers
2. asked by chelsea
3. 2,347 views
Still, do-it-yourself renovations is usually a source of pride for new homeowners, no matter how hard or how frustrating.what
1. 7 answers
2. asked by Ruth
3. 2,096 views
the sum of three forces f1=100n, f2=80n, f3=60n acting on a particle is zero.The angle between f1 and f2 is: Please solve
1. 2 answers
2. asked by marley
3. 2,048 views
The wildlife department has been feeding a special food to rainbow trout fingerlings in a pond. A sample of the weights of 40
1. 1 answer
2. asked by Brad
3. 2,039 views
A rectangular prism has dimensions of x + 1, x - 1, and x.Write an expression for the total volume of the prism.
1. 4 answers
2. asked by bruce
3. 2,011 views
Doctors in the field of preventive medicine concentrate on "preventing disease and to encourage" good health practices.Best way
1. 5 answers
2. asked by Ruth
3. 1,902 views
They emphasized the importance of good maternal and child health care, including the administering of vaccines.what correction
1. 10 answers
2. asked by Ruth
3. 1,853 views
I'm kinda stuck on my math homework, does anyone know how to do it?The results of a blood test at a medical lab are normally
1. 1 answer
2. asked by Andy
3. 1,818 views
A store manager believes that 42% of her customers are repeat business (have visited her store within the last two weeks).
1. 2 answers
2. asked by Babyboo
3. 1,776 views
Determine whether the given numbers are solutions of the inequality. y-8>2y-34, -11, -19, -1 (are any of these numbers a
1. 1 answer
2. asked by Ann
3. 1,701 views
Make a poster to advertise the cause of one of ...-The Confederationists -The Anti-Confederationists -The Annexationists Try to
1. 17 answers
2. asked by Emma
3. 1,279 views
The Lifetimes of a certain brand of photographic light are normally distributed with the mean of 210 h and a standard deviation
1. 1 answer
2. asked by Jerry
3. 1,259 views
if you could help please do3. A document camera is more versatile than an opaque projector because you can use it to A. record
1. 1 answer
2. asked by beth
3. 1,248 views
Sketch the region bounded by the curves y = x^2, y = x^4.1) Find the area of the region enclosed by the two curves; 2) Find the
1. 1 answer
2. asked by Megan
3. 1,186 views
What transportation vessel and animal are on the family crest of the McDonalds of Scotland ? (Mr. G's ancestors)
1. 2 answers
2. asked by dave
3. 1,162 views
A parallel plate air capacitor of capacitance 245pF has a charge of magnitude 0.148ìC on each plate. The plates are 0.328mm
1. 3 answers
2. asked by Rohan Khan
3. 1,145 views
Q.1 Prove the following identities:-(i) tan^3x/1+tan^2x + cot^3x/1+cot^2 = 1-2sin^x cos^x/sinx cosx (ii)
1. 1 answer
2. asked by MATHS
3. 1,141 views
cannot figure out the probability for the following: A pea plant i=must have exactly on of each of the following pairs of
1. 2 answers
2. asked by Joyce
3. 1,141 views
given vectors ,Vector a= 2i + 3j, then the angle between vector a and y axis is? Plz solve
1. 1 answer
2. asked by marley
3. 1,137 views
How tall would a glass (in the shape of a right circular cylinder) with a diameter of 3 inches need to be to hold 12 oz?
1. 3 answers
2. asked by Shay
3. 1,105 views
fraction word problem. please advise on how to work the problemPhillip and Jane had a pie each. Phippip ate 1/4 of his and Jane
1. 2 answers
2. asked by Suzanne
3. 1,096 views
Describe three issues related to role confusion that a teacher may feel or may communicate.
1. 3 answers
2. asked by sue
3. 1,090 views
Phil had an unpaid balance of $1,854.50 on his credit card statement at the beginning of December. He made a payment of $45.00
1. 0 answers
2. asked by CC
3. 1,065 views
in the crucible act 4, which reason does herrick give for drinking?a. it keeps him warm b. he is upset about the hangings c. he
1. 4 answers
2. asked by Anonymous
3. 1,065 views
. A box contains five blue, eight green, and three yellow marbles. If a marble is selected at random, what is the probability
1. 1 answer
2. asked by CC
3. 1,063 views
A plane is flying at 240mph and is climbing at 22 degrees. Find the rate at which it is gaining altitude when y=3miles
1. 1 answer
2. asked by ron
3. 1,041 views
Two institution/community that are involved in supporting or giving redress to teenage pregnancy
1. 0 answers
2. asked by Nadia
3. 1,040 views
Question: 2 of 40: Which of the following circle equations represents a circle whose center is at (0, 0)?Select one of the
1. 2 answers
2. asked by kieara
3. 1,021 views
two kinds of shapes when an object is placed in a picture plane area are called
1. 1 answer
2. asked by Anonymous
3. 1,015 views
In this memory process, the individual records information to prepare it to be entered into memory.Storage Encoding Retrieval
1. 2 answers
2. asked by Jesse
3. 986 views
If two people are selected at random, what is the probability that they were both born in winter (December, January, or
1. 1 answer
2. asked by CC
3. 971 views
How Might You Determine If InformatiOn Found Online Is Trustworthy Describe Credibility Issues With InformatiOn Found On The
1. 0 answers
2. asked by jackie
3. 970 views
Since the Hernandez family has experienced discrimination, hardship, and recent bullying in their neighborhood, Mr. Hernandez
1. 10 answers
2. asked by Anonymous
3. 969 views
A 0.200-m uniform bar has a mass of 0.750 kg and is released from rest in the vertical position, as the drawing indicates. The
1. 0 answers
2. asked by Karen
3. 963 views
what was john walthall alleged offense?how might one account for the ferocity of the assault on carter's family walthall? I
1. 1 answer
2. asked by heather
3. 945 views
How did the Emancipation Proclamation change the nature of the Civil War, if it did at when he issued it ?
1. 1 answer
2. asked by Joanne
3. 944 views
The Fast Delivery Service submitted the transactions given below. Analyze these business transactions.a. On October 1st, Joseph
1. 1 answer
2. asked by mary
3. 940 views
A person with body resistance between his hands of 10KÙ accidently grasps the terminal of a 14-KV power supply.(a) If the
1. 1 answer
2. asked by Rohan Khan
3. 933 views
Jeff walls a sudden gust of wind (after Hokusai is a_______ that refers to a _____
1. 1 answer
2. asked by Anonymous
3. 900 views
A 20 ounce bag of popcorn costs $2.80 at the movie theater, if the unit price remains the same, how much would a 35 ounce bag
1. 4 answers
2. asked by Kelly
3. 899 views
Write the solution in interval notation x<5 and x>=-2.) What would the compound inequality look like? Thanks for the help!
1. 1 answer
2. asked by Ann
3. 891 views
Sentence 10: Finally, friends whom you haven't seen in years, long-lost relatives, and even mere acquaintances will begin
1. 3 answers
2. asked by Ruth
3. 891 views
I am so tired of seemingly educated students not knowing how to form complete sentences or spell. If you really want to make an
1. 1 answer
2. asked by Pat
3. 876 views
Jane is using a recipe to bake cookies.Recipe calls fo a little less than 1/2 of choc chips. Which amount is less than 1/2?4/8
1. 3 answers
2. asked by Suzanne
3. 869 views
***Is this correct?Review the four paragraphs below. There is one paragraph matching each of the following types: summary,
1. 1 answer
2. asked by Angelina
3. 868 views
Katie had an unpaid balance of $1,734.50 on her credit card statement at the beginning of January. She made a payment of $165.00
1. 0 answers
2. asked by CC
3. 864 views
solve using the subsitution method4x+4y=36 4x+4y=12 If the system has no solution or an infinite number of solutions, please
1. 1 answer
2. asked by mema
3. 805 views
If y = e^x cosx, prove that dy/dx sqrt(2) e^x . cos(x+ pie/4)
1. 1 answer
2. asked by Akash
3. 796 views
When a single card is drawn from a shuffled deck of cards, find the odds against getting a 9.
1. 1 answer
2. asked by CC
3. 794 views
I need help with a lab report on extraction of iodine by dichloromethane, please help!
1. 2 answers
2. asked by Delia
3. 776 views
a bungee jumper whit mass 65. kg jumps from a high bridge. after reaching his lowest point. he oscillates ud a down, hitting a
1. 0 answers
2. asked by Diego
3. 765 views
Two dice are rolled. Find the probability of getting a sum greater than 8.0 13/36 2/9 5/18
1. 2 answers
2. asked by CC
3. 752 views
A sample of oxygen occupies 38.9L at STP. What will the pressure need to be in Torr. if the volume is to be changed to 32.2L
1. 2 answers
2. asked by kathleen
3. 715 views
the only property listed that is not characteristic of ionic compounds is
1. 2 answers
2. asked by fatou
3. 711 views
1. Draw a simple random sample of 15 students from your class, and calculate sample mean and sample variance of their
1. 1 answer
2. asked by sireesha
3. 709 views
what are the arrangement and motions of molecules of substances in the solid phase, liquid phase, and gaseous phase?
1. 2 answers
2. asked by harold
3. 697 views
In a shop there are 20 customers, 18 of whom will make a purchase. If three customers are selected, one at a time, at random,
1. 1 answer
2. asked by CC
3. 688 views
Was the Battle of Antietam a Union victory, defeat, or was it a stalemate ? Give reasons for your answer.
1. 3 answers
2. asked by Joanne
3. 687 views
***I know the identifying is done correctly I just need to know if the paragraph is grammatically correct and makes since.***Sor
1. 2 answers
2. asked by Angelina
3. 687 views
Aaron had an unpaid balance of $1,177.79 on his credit card statement at the beginning of April. He made a payment of $430.00
1. 0 answers
2. asked by CC
3. 669 views
1) If the odds in favor of an event A are 3 to 1, what is the probability associated with event A occurring?A) B) C) 4 D)
1. 1 answer
2. asked by KEL
3. 650 views
2008 (2nd)Course2-4.1We are to find a function f(x) such that its derivative is x^2+x-1 and the graph of y=f(x) is tangent to
1. 0 answers
2. asked by Bayarbold
3. 649 views
mandy used a square card board to make an open box by cutting small squares from its corners and then bending the sides.The
1. 1 answer
2. asked by rowena
3. 640 views
***I know that the identifying is correct just need to make sure the final paragraph is grammatically correct and makes since.Re
1. 1 answer
2. asked by Angelina
3. 633 views
Repeatedly reciting a sequence of words:A) activates different brain areas than when the word sequence is spoken the first time.
1. 2 answers
2. asked by Jesse
3. 624 views
What is the Ka value of acetic acid from the pH of the buffered solution? pH=4.39 of 25ml of HC2H3O2 with .410g NaC2H3O2 added.K
1. 1 answer
2. asked by Anonymous
3. 619 views
I did a lab with catalase breaking down hydrogen peroxide. A question asks, what gas is being formed (oxygen), suggest a method
1. 1 answer
2. asked by Tone
3. 604 views
" four less than twice a number is greater than six " Can someone please write that as an expression ?
1. 3 answers
2. asked by Maria
3. 602 views
what is a direct performative aspect? (as in poetry or drama)
1. 2 answers
2. asked by rita
3. 597 views
This man was responsible for the painting of the Sistine Chapel, as he spent 4 years lying on his back atop a scaffold , just a
1. 0 answers
2. asked by dave
3. 592 views
The souls of black folk, was this essay optimistic or pessimistic about future of US race relation?
1. 4 answers
2. asked by Anonymous
3. 590 views
I got this of this web site but I don't understand where it all goes. this is the one I am working on. I need help.Part 1
1. 1 answer
2. asked by shawna
3. 589 views
I would really like help for this question ASAP! pleasee! I thank you ahead of time.The question refers to an experiment using
1. 1 answer
2. asked by md.
3. 587 views
A $400 loan is to be paid off in 66 monthly payments of $11.62. The borrower decides to pay off the loan after 18 payments. Use
1. 2 answers
2. asked by CC
3. 586 views
During the 1980s El Salvador faced a multiyear civil war battle fighting against guerillas who were trying to destroy the
1. 4 answers
2. asked by Anonymous
3. 581 views
A charge Q is to be divided on two objects. What should be the values of the charges on the object so that the force between the
1. 1 answer
2. asked by saradi
3. 579 views
I'm kinda stuck on my math homework, does anyone know how to do it?The results of a blood test at a medical lab are normally
1. 1 answer
2. asked by Andy
3. 575 views
1.)P(-15/17,-8/17) is found on the unit crcle. find sin0 and cos0.2.)solve: x=Arc tan(-sq root3). 3.)find sec0 if sin0=-4/5 and
1. 1 answer
2. asked by Liddy
3. 575 views
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
2. asked by Sonya
3. 574 views
How might the increase in medical technology have a negative effect on communication among providers? Provide at least two
1. 0 answers
2. asked by tina
3. 573 views
If y is inversely proportional to x, and y=8 when x=2, find y when x=5
1. 1 answer
2. asked by Mindy
3. 567 views
Two dice are rolled. Find the probability of getting a 5 on either die or the sum of both dice is 5.
1. 1 answer
2. asked by CC
3. 566 views
what expression represents the area of the base of the box
1. 1 answer
2. asked by rowena
3. 565 views
***Is this correct?Review the four paragraphs below. There is one paragraph matching each of the following types: summary,
1. 3 answers
2. asked by Angelina
3. 565 views
What is the verb in the following sentence Her outgoing voice mail message sounds professional?
1. 1 answer
2. asked by sue
3. 564 views
I would really like help for this question ASAP! pleasee! I thank you ahead of time.The question refers to an experiment using
1. 1 answer
2. asked by md.
3. 559 views
a bag contains red and blue marbles. with 10% more blue marbles than red. a)what is the probability of selecting 5 blue marbels
1. 5 answers
2. asked by pedro1
3. 559 views
How do I figure FUTA/SUTA earnings? This is what my book gives:James Company has three employees .Its payroll information is
1. 0 answers
2. asked by Nick
3. 559 views
Determine whether the given numbers are solutions of the inequality.4, -11, -19, -1 y-8>2y-3 Are any of these numbers a solution
1. 1 answer
2. asked by samae
3. 556 views
• After solving a system of linear equations, how can you check your answer to determine whether it is correct? Demonstrate
1. 1 answer
2. asked by Gladys
3. 544 views
fraction word problem. please advise on how to work the problemPhillip and Jane had a pie each. Phippip ate 1/4 of his and Jane
1. 1 answer
2. asked by Suzanne
3. 543 views
If two people are selected at random, what is the probability that they were both born in May?
1. 1 answer
2. asked by CC
3. 540 views

Back to June 2011

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2025