Archives
2011
June

Questions Asked on June 10, 2011

a runner training for a race times her 400 meter laps around a track. her times are lap 1 60 seconds, lap 2 57 seconds, lap 3 55
1. 2 answers
2. asked by Quetta
3. 5,510 views
a force f= 3i+cj+2k acting on a particle causes displacement , d=-4i+2j+3k.If the work done is 6 joule then the value of c. Plz.
1. 2 answers
2. asked by marley
3. 3,260 views
Doctors in the field of preventive medicine concentrate on "preventing disease and to encourage" good health practices.Best way
1. 5 answers
2. asked by Ruth
3. 1,882 views
what is the power dissipated by a 10 ohm resistor through which a 2 ampere current is flowing?
1. 1 answer
2. asked by harold
3. 3,961 views
I'm kinda stuck on my math homework, does anyone know how to do it?The results of a blood test at a medical lab are normally
1. 1 answer
2. asked by Andy
3. 1,804 views
Was the Battle of Antietam a Union victory, defeat, or was it a stalemate ? Give reasons for your answer.
1. 3 answers
2. asked by Joanne
3. 677 views
I would really like help for this question ASAP! pleasee! I thank you ahead of time.The question refers to an experiment using
1. 1 answer
2. asked by md.
3. 545 views
How did the Emancipation Proclamation change the nature of the Civil War, if it did at when he issued it ?
1. 1 answer
2. asked by Joanne
3. 929 views
Make a poster to advertise the cause of one of ...-The Confederationists -The Anti-Confederationists -The Annexationists Try to
1. 17 answers
2. asked by Emma
3. 1,266 views
Was the Emancipation Proclamation more important to the American domestic audience with European powers ?
1. 3 answers
2. asked by Joanne
3. 459 views
How might the increase in medical technology have a negative effect on communication among providers? Provide at least two
1. 1 answer
2. asked by tina
3. 519 views
What is the verb in the following sentence Her outgoing voice mail message sounds professional?
1. 1 answer
2. asked by sue
3. 550 views
How might the increase in medical technology have a negative effect on communication among providers? Provide at least two
1. 0 answers
2. asked by tina
3. 564 views
Sketch the region bounded by the curves y = x^2, y = x^4.1) Find the area of the region enclosed by the two curves; 2) Find the
1. 1 answer
2. asked by Megan
3. 1,171 views
solving the equation (x+4)(x-4)=9 Eric stated that the solution would be x+4=9>x=5 or (x-4)=9=>x=13However one of these solution
1. 0 answers
2. asked by mema
3. 406 views
I would really like help for this question ASAP! pleasee! I thank you ahead of time.The question refers to an experiment using
1. 1 answer
2. asked by md.
3. 578 views
If a stone is thossed from the top of a 230 meter building, the height of the ston as a function of time is given by
1. 0 answers
2. asked by mema
3. 384 views
Use the discriminant to determine the following equations have that are two different rational solutions:two different
1. 0 answers
2. asked by mema
3. 402 views
solve using the subsitution method4x+4y=36 4x+4y=12 If the system has no solution or an infinite number of solutions, please
1. 1 answer
2. asked by mema
3. 795 views
Solve using the elinination method2x+2y=20 2x-2y=4
1. 1 answer
2. asked by mema
3. 397 views
What is the Ka value of acetic acid from the pH of the buffered solution? pH=4.39 of 25ml of HC2H3O2 with .410g NaC2H3O2 added.K
1. 1 answer
2. asked by Anonymous
3. 602 views
write with postive exponents. Assume that even roots are nonnegative quantities and the demoninators are non zero(2x/y^2)-^4
1. 0 answers
2. asked by mema
3. 429 views
The most useful indicator of the degree of democracy reached by a particular society is whether it has a?
1. 1 answer
2. asked by Shondreka
3. 419 views
• After solving a system of linear equations, how can you check your answer to determine whether it is correct? Demonstrate
1. 1 answer
2. asked by Gladys
3. 533 views
express in terms of i3/-104
1. 0 answers
2. asked by mema
3. 296 views
find the second order derivative, rxy(x,y) for r(x,y)=xy/8x+5y
1. 0 answers
2. asked by Chris
3. 351 views
Subtract(4x+17xy-9y)-(5x-8xy)
1. 1 answer
2. asked by mema
3. 449 views
Given the quadratic function f(x)=9x^2-36x+36 find a value of x such that f(x)=9
1. 1 answer
2. asked by mema
3. 388 views
Joe has a collection of nickles and dimes that is worth $7.65.If the number of dimes was doubled and the number of nickles was
1. 1 answer
2. asked by mema
3. 524 views
Use polynominal long division to divide-4x^3+24x^2-24x+4 by x^2-5x+1
1. 1 answer
2. asked by mema
3. 507 views
Multiply-5x+4 by 4x^2+x
1. 1 answer
2. asked by mema
3. 370 views
x^2+2x-15=0solve by completing the square
1. 1 answer
2. asked by Angel
3. 413 views
two forces of 14and 30 act on a body forming an obtuse angle w/ eachother. if the resultant is 60, whats the angle betweeen the
1. 1 answer
2. asked by Angel
3. 464 views
what is a direct performative aspect? (as in poetry or drama)
1. 2 answers
2. asked by rita
3. 577 views
if you could help please do3. A document camera is more versatile than an opaque projector because you can use it to A. record
1. 1 answer
2. asked by beth
3. 1,234 views
I want to shampoo my mattress with a cleanser. On the directions it reads "Do not use on products coded "X"Om my mattress under
1. 3 answers
2. asked by Willy Wonka
3. 511 views
A sample of oxygen occupies 38.9L at STP. What will the pressure need to be in Torr. if the volume is to be changed to 32.2L
1. 2 answers
2. asked by kathleen
3. 704 views
what was john walthall alleged offense?how might one account for the ferocity of the assault on carter's family walthall? I
1. 1 answer
2. asked by heather
3. 939 views
I did a lab with catalase breaking down hydrogen peroxide. A question asks, what gas is being formed (oxygen), suggest a method
1. 1 answer
2. asked by Tone
3. 588 views
give the value of tan(arctan x+1/x-1+arctanx-1/x)
1. 0 answers
2. asked by Mike
3. 397 views
65% of 13
1. 1 answer
2. asked by Anonymous
3. 241 views
Determine whether the given numbers are solutions of the inequality.4, -11, -19, -1 y-8>2y-3 Are any of these numbers a solution
1. 1 answer
2. asked by samae
3. 543 views
65% of 13
1. 1 answer
2. asked by Anonymous
3. 238 views
I'm kinda stuck on my math homework, does anyone know how to do it?The results of a blood test at a medical lab are normally
1. 1 answer
2. asked by Andy
3. 560 views
The Lifetimes of a certain brand of photographic light are normally distributed with the mean of 210 h and a standard deviation
1. 1 answer
2. asked by Jerry
3. 1,244 views
A 0.200-m uniform bar has a mass of 0.750 kg and is released from rest in the vertical position, as the drawing indicates. The
1. 0 answers
2. asked by Karen
3. 951 views
Ms. Sue - thank you for your answer. i understand the second question now but i really don't know much why. is it because at
1. 1 answer
2. asked by heather
3. 430 views
In this memory process, the individual records information to prepare it to be entered into memory.Storage Encoding Retrieval
1. 2 answers
2. asked by Jesse
3. 967 views
Dr. Collins borrowed some money to buy new furniture for her office. She paid $720.00 simple interest on a 7.5-year loan at 16%.
1. 1 answer
2. asked by CC
3. 515 views
Repeatedly reciting a sequence of words:A) activates different brain areas than when the word sequence is spoken the first time.
1. 2 answers
2. asked by Jesse
3. 607 views
Two dice are rolled. Find the probability of getting a sum greater than 8.0 13/36 2/9 5/18
1. 2 answers
2. asked by CC
3. 739 views
fraction word problem. please advise on how to work the problemPhillip and Jane had a pie each. Phippip ate 1/4 of his and Jane
1. 1 answer
2. asked by Suzanne
3. 530 views
Aaron had an unpaid balance of $1,177.79 on his credit card statement at the beginning of April. He made a payment of $430.00
1. 0 answers
2. asked by CC
3. 656 views
. A box contains five blue, eight green, and three yellow marbles. If a marble is selected at random, what is the probability
1. 1 answer
2. asked by CC
3. 1,045 views
Phil had an unpaid balance of $1,854.50 on his credit card statement at the beginning of December. He made a payment of $45.00
1. 0 answers
2. asked by CC
3. 1,046 views
When a single card is drawn from a shuffled deck of cards, find the odds against getting a 9.
1. 1 answer
2. asked by CC
3. 783 views
Determine whether the given numbers are solutions of the inequality. y-8>2y-34, -11, -19, -1 (are any of these numbers a
1. 1 answer
2. asked by Ann
3. 1,681 views
A $400 loan is to be paid off in 66 monthly payments of $11.62. The borrower decides to pay off the loan after 18 payments. Use
1. 2 answers
2. asked by CC
3. 577 views
A company borrowed $1500. It must make monthly payments of $40.50 for 42 months to pay off the loan. Use the constant ratio
1. 1 answer
2. asked by CC
3. 398 views
coat with an original price of $300.00 is on sale for $285.00. Find the percent of the markdown.
1. 1 answer
2. asked by CC
3. 429 views
If two people are selected at random, what is the probability that they were both born in winter (December, January, or
1. 1 answer
2. asked by CC
3. 959 views
Two dice are rolled. Find the probability of getting a 5 on either die or the sum of both dice is 5.
1. 1 answer
2. asked by CC
3. 553 views
Katie had an unpaid balance of $1,734.50 on her credit card statement at the beginning of January. She made a payment of $165.00
1. 0 answers
2. asked by CC
3. 850 views
If two people are selected at random, what is the probability that they were both born in May?
1. 1 answer
2. asked by CC
3. 527 views
In a shop there are 20 customers, 18 of whom will make a purchase. If three customers are selected, one at a time, at random,
1. 1 answer
2. asked by CC
3. 676 views
What transportation vessel and animal are on the family crest of the McDonalds of Scotland ? (Mr. G's ancestors)
1. 2 answers
2. asked by dave
3. 1,153 views
Which numbr is greater than 3/4.The possible answers are 75/100 , 11/12, 2/3 or 3/8. I thought that I would try the method of
1. 1 answer
2. asked by Linda
3. 526 views
On August 26, 1989, a train in south africa carried a record number of 660 cars. what was the length of the train?
1. 1 answer
2. asked by Anonymous
3. 509 views
This man was responsible for the painting of the Sistine Chapel, as he spent 4 years lying on his back atop a scaffold , just a
1. 0 answers
2. asked by dave
3. 577 views
when two forces of magnitude p and q are perpendicular to each other their resultant is of magnitude 'r'. When they are at an
1. 0 answers
2. asked by marley
3. 515 views
the sum of three forces f1=100n, f2=80n, f3=60n acting on a particle is zero.The angle between f1 and f2 is: Please solve
1. 2 answers
2. asked by marley
3. 2,029 views
two forces are in the ratio 1:2 named p and q.if their resultant is at an angle tan inverse root 3 /2 to vector p then the angle
1. 0 answers
2. asked by marley
3. 450 views
Write the solution in interval notation x<5 and x>=-2.) What would the compound inequality look like? Thanks for the help!
1. 1 answer
2. asked by Ann
3. 879 views
The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???):!!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAAC
1. 0 answers
2. asked by Sonya
3. 561 views
A fair number cube is rolled twice. W aht is the probbability that the first roll will be even and the second roll will be odd
1. 1 answer
2. asked by zina
3. 448 views
fraction word problem. please advise on how to work the problemPhillip and Jane had a pie each. Phippip ate 1/4 of his and Jane
1. 2 answers
2. asked by Suzanne
3. 1,081 views
A charge Q is to be divided on two objects. What should be the values of the charges on the object so that the force between the
1. 1 answer
2. asked by saradi
3. 560 views
Jane is using a recipe to bake cookies.Recipe calls fo a little less than 1/2 of choc chips. Which amount is less than 1/2?4/8
1. 3 answers
2. asked by Suzanne
3. 862 views
If y= (x-1)log(x-1)-(x+1)log(x+1), prove that dy/dx = log(x-1/1+x)
1. 1 answer
2. asked by Akash
3. 388 views
How Might You Determine If InformatiOn Found Online Is Trustworthy Describe Credibility Issues With InformatiOn Found On The
1. 0 answers
2. asked by jackie
3. 959 views
a bungee jumper whit mass 65. kg jumps from a high bridge. after reaching his lowest point. he oscillates ud a down, hitting a
1. 0 answers
2. asked by Diego
3. 757 views
If y = e^x cosx, prove that dy/dx sqrt(2) e^x . cos(x+ pie/4)
1. 1 answer
2. asked by Akash
3. 782 views
given vectors ,Vector a= 2i + 3j, then the angle between vector a and y axis is? Plz solve
1. 1 answer
2. asked by marley
3. 1,121 views
A parallel plate air capacitor of capacitance 245pF has a charge of magnitude 0.148ìC on each plate. The plates are 0.328mm
1. 3 answers
2. asked by Rohan Khan
3. 1,125 views
A cylindrical copper cable 1.50Km long is connected across a 220.0V potential difference.(a) What should be its diameter so that
1. 1 answer
2. asked by Rohan Khan
3. 2,382 views
A person with body resistance between his hands of 10KÙ accidently grasps the terminal of a 14-KV power supply.(a) If the
1. 1 answer
2. asked by Rohan Khan
3. 917 views
x2 - 2x - 13 = 0
1. 1 answer
2. asked by CC
3. 246 views
x2 - 2x - 13 = 0
1. 1 answer
2. asked by CC
3. 285 views
vector a+ vector b= 2iVector a+ vector b=4j Then the angle between vector a and vector b is ? Plz.solve
1. 1 answer
2. asked by marley
3. 492 views
x2 + 12x - 64 = 0
1. 1 answer
2. asked by CC
3. 432 views
Two institution/community that are involved in supporting or giving redress to teenage pregnancy
1. 0 answers
2. asked by Nadia
3. 1,027 views
I need to make an acrostic poem for science. My teacher said that each letter needs to start a sentence about plant life. The
1. 10 answers
2. asked by Hanna
3. 2,531 views
1. Draw a simple random sample of 15 students from your class, and calculate sample mean and sample variance of their
1. 1 answer
2. asked by sireesha
3. 694 views
How do we incorporate social and cultural forces in marketing systems?
1. 0 answers
2. asked by Daniel
3. 365 views
I am so tired of seemingly educated students not knowing how to form complete sentences or spell. If you really want to make an
1. 1 answer
2. asked by Pat
3. 865 views
Q.1 different between acid and bases.Q.2 Define Olfactory indicators.
1. 1 answer
2. asked by roushan
3. 430 views
If y is inversely proportional to x, and y=8 when x=2, find y when x=5
1. 1 answer
2. asked by Mindy
3. 556 views
The displacement of a linear damped oscillator is given, for weak damping byx=Ke^(-bΩt) sin⁡(βt+ ε) Show x has a maximum at
1. 1 answer
2. asked by Bob
3. 436 views
Q.1 Prove the following identities:-(i) tan^3x/1+tan^2x + cot^3x/1+cot^2 = 1-2sin^x cos^x/sinx cosx (ii)
1. 1 answer
2. asked by MATHS
3. 1,119 views
solve the following.1) x^3+3y^3+x+2y
1. 2 answers
2. asked by MATHS
3. 333 views

Back to June 2011

Ask a New Question

Archives
Contact Us
Newest
Privacy Policy
Terms of Use
© 2024